Thursday, November 28, 2019
Summarise Key Aspects of Legislation free essay sample
In order to keep up with the changes, I need to ensure that I meet the highest possible standards. Following this, I must be committed to my own professional learning, seeking to expand my skills and to deepen my knowledge as a teacher. Now Iââ¬â¢m going to say a few words about some of the most important legislations that comply with in order to become a good teacher. Calin Rusu Confidentiality and Data protection Act (1998) are very important legislations for a teacher being linked to the Domains A and E from LLUK standards. Learners expect us to respect and protect confidentiality. This duty extends to any information relating to a learner which we acquire in the course of our work. Confidential information includes personal details. ââ¬Å"Confidentiality can be defined as when one person receives personal or sensitive information from another person, then that person who receives the information has a duty not to pass it on to any other person without the consent of the person who confided in them. We will write a custom essay sample on Summarise Key Aspects of Legislation or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page â⬠As a professional teacher, I wonââ¬â¢t share any information regarding my students unless the situation requires it. Iââ¬â¢ll do my best to keep safe the information they are sharing with me and to gain their trust, if they will trust me then theyââ¬â¢ll feel safe in my classroom. ââ¬Å"The Data Protection Act 1998 (DPA 1998) is an act of the United Kingdom (UK) Parliament defining the ways in which information about living people may be legally used and handled. The main intent is to protect individuals against misuse or abuse of information about them. â⬠Calin Rusu Equality and Diversity Act (2010) is another important legislation which is linked to every LLUK standard. In my opinion, knowing and understanding the Equality and Diversity Act is crucial for me as a teacher in order to assess every learners needs and to meet these needs. It is not easy to treat all my students equally, especially if they are different nationalities, different races, different backgrounds and maybe with disabilities. But, with the initial assessment rrrr,,,, and choosing the right learning strategies and resources Iââ¬â¢m sure Iââ¬â¢ll be able to meet every learners needs. In order to succeed in meeting all my learnersââ¬â¢ needs, Iââ¬â¢ll use group tasks; Iââ¬â¢ll differentiate them according to their level of knowledge, their learning styles, and by their disability if this is applicable without letting them feel discriminated. Disability Act (2010) refers to those people whom got a medical condition that requires special attention and extra care and helps us, as teachers to treat them equally and not let them feel excluded, this Act can be linked to A, B and F Domains from LLUK standards. If in my course of work Iââ¬â¢ll have to deal with a disabled learner Iââ¬â¢ll try to plan the session according www,,, to this and prepare for him appropriate tasks. Iââ¬â¢ll try to widen my knowledge about his/her disability to know better his/her needs and what teaching strategies do I have to use for him/her to achieve. Another important legislation which can be linked to A, B and F Domains of the LLUK standards is Discrimination Act (2010) which explains how I, as a teacher must treat everybody equally no matter what their sex is, religion, race, age or sex orientation. Health and Safety Act (1974) and Management of Health and Safety Regulations (1999) are two of the most important pieces in Health and Safety legislation being linked to all LLUK standards Domains. These legislations were enacted in order to set the standards that must be met to ensure the health and safety of all employees, learners and all others who may be affected by any work activity. References: Calin Rusu http://www. atl. org. k/health-and-safety/legal-framework/health-safety-legislation. asp (accessed on 22. 05. 2013) http://www. psnc. org. uk/data/files/PharmacyContractandServices/ClinicalGovernance/briefing_on_confidentiality. pdf (accessed on 17. 05. 2013) http://www. kingston. gov. uk ââ¬Å"Learner Confidentiality and Data Protection Policyâ⬠(accessed on 17. 05. 2013) http://searchstorage. techtarget. co. uk ââ¬Å"DEFINITION U. K. Data Protection Act 1998 (DPA 1998)â⬠(accessed on 17. 05. 2013)
Summarise Key Aspects of Legislation free essay sample
In order to keep up with the changes, I need to ensure that I meet the highest possible standards. Following this, I must be committed to my own professional learning, seeking to expand my skills and to deepen my knowledge as a teacher. Now Iââ¬â¢m going to say a few words about some of the most important legislations that comply with in order to become a good teacher. Calin Rusu Confidentiality and Data protection Act (1998) are very important legislations for a teacher being linked to the Domains A and E from LLUK standards. Learners expect us to respect and protect confidentiality. This duty extends to any information relating to a learner which we acquire in the course of our work. Confidential information includes personal details. ââ¬Å"Confidentiality can be defined as when one person receives personal or sensitive information from another person, then that person who receives the information has a duty not to pass it on to any other person without the consent of the person who confided in them. We will write a custom essay sample on Summarise Key Aspects of Legislation or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page â⬠As a professional teacher, I wonââ¬â¢t share any information regarding my students unless the situation requires it. Iââ¬â¢ll do my best to keep safe the information they are sharing with me and to gain their trust, if they will trust me then theyââ¬â¢ll feel safe in my classroom. ââ¬Å"The Data Protection Act 1998 (DPA 1998) is an act of the United Kingdom (UK) Parliament defining the ways in which information about living people may be legally used and handled. The main intent is to protect individuals against misuse or abuse of information about them. â⬠Calin Rusu Equality and Diversity Act (2010) is another important legislation which is linked to every LLUK standard. In my opinion, knowing and understanding the Equality and Diversity Act is crucial for me as a teacher in order to assess every learners needs and to meet these needs. It is not easy to treat all my students equally, especially if they are different nationalities, different races, different backgrounds and maybe with disabilities. But, with the initial assessment rrrr,,,, and choosing the right learning strategies and resources Iââ¬â¢m sure Iââ¬â¢ll be able to meet every learners needs. In order to succeed in meeting all my learnersââ¬â¢ needs, Iââ¬â¢ll use group tasks; Iââ¬â¢ll differentiate them according to their level of knowledge, their learning styles, and by their disability if this is applicable without letting them feel discriminated. Disability Act (2010) refers to those people whom got a medical condition that requires special attention and extra care and helps us, as teachers to treat them equally and not let them feel excluded, this Act can be linked to A, B and F Domains from LLUK standards. If in my course of work Iââ¬â¢ll have to deal with a disabled learner Iââ¬â¢ll try to plan the session according www,,, to this and prepare for him appropriate tasks. Iââ¬â¢ll try to widen my knowledge about his/her disability to know better his/her needs and what teaching strategies do I have to use for him/her to achieve. Another important legislation which can be linked to A, B and F Domains of the LLUK standards is Discrimination Act (2010) which explains how I, as a teacher must treat everybody equally no matter what their sex is, religion, race, age or sex orientation. Health and Safety Act (1974) and Management of Health and Safety Regulations (1999) are two of the most important pieces in Health and Safety legislation being linked to all LLUK standards Domains. These legislations were enacted in order to set the standards that must be met to ensure the health and safety of all employees, learners and all others who may be affected by any work activity. References: Calin Rusu http://www. atl. org. k/health-and-safety/legal-framework/health-safety-legislation. asp (accessed on 22. 05. 2013) http://www. psnc. org. uk/data/files/PharmacyContractandServices/ClinicalGovernance/briefing_on_confidentiality. pdf (accessed on 17. 05. 2013) http://www. kingston. gov. uk ââ¬Å"Learner Confidentiality and Data Protection Policyâ⬠(accessed on 17. 05. 2013) http://searchstorage. techtarget. co. uk ââ¬Å"DEFINITION U. K. Data Protection Act 1998 (DPA 1998)â⬠(accessed on 17. 05. 2013)
Monday, November 25, 2019
What is Artistic Beauty essays
What is Artistic Beauty essays Dr. Marck L. Beggs, Director M.L.A. Program What is Artistic Beauty? From the beginning of time, men and women have scrutinized, categorized, and compared components of their surroundings in an attempt to better understand their world. In the Bibles Genesis account, Adam, seemingly in appreciation of Eves uniqueness and beauty, poetically proclaims her, bone of my bones and flesh of my flesh; she shall be called woman, for she was taken out of man.[Gen. 2:23 NIV] Much later, artists, writers, and philosophers have sought to understand beauty, balance, and perfection the sublime. Their struggle to define perfection and to set standards of beauty was termed aesthetics or, the science of the beautiful, in 1753 by German philosopher Alexander Gottlieb Baumgarten. Baumgarten was considered the first modern philosopher to approach the question of beauty systematically, introducing the term aesthetics and defining the experience of beauty as the sensory recognition of perfection. [Danto 1]. The works of his contemporary, Immanuel Kant, express the notion that beautiful objects are without a specific purpose and that judgments of beauty are not expressions of mere personal preference but, rather, universal. Similarly, Encarta defines aesthetics as: A branch of philosophy concerned with the essence and perception of beauty and ugliness, dealing with the question of whether such qualities are objectively present in the things they appear to qualify, or whether they exist only in the mind of the individual; hence, whether objects are perceived by a particular mode, the aesthetic mode, or whether instead the objects have, in themselves, special aesthetic qualities. Philosophy also asks if there is a difference between the beautiful and the sublime. [Danto 1] However, even with a definition at hand, arriving at a consensus on precisely what c...
Thursday, November 21, 2019
Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words
Gene Analysis - Essay Example Gene therapy, integrating vectors carrying therapeutic transgene sequences offers the potential for a permanent cure of genetic diseases by stable vector insertion into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic animal and that's why it is important to know probability of non specific integration of this transgene and its effect on cellular homeostasis. As per the present understanding the integration is semi-random in nature and having partial preference towards sequences in or near the coding regions of expressed genes (1). Integration in these places may lead to up or down regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of given vectors in model system. Based on bio-informatical analysis of given sequence, we were able to demonstrated that Viral vector integra tes in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. Detailed investigation and database search indicates Nfib has potential role in cell cycle regulation and oncogenesis. Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was BLAST against the Mouse genome database (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http://genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http://rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base. GeneSequence: 5'AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3' Results and discussion: The sequence was used for similarity search by BLAST in mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of given sequence. FIG 1: BLAST results >ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6J Length=28591323 Features in this part of subject sequence: nuclear factor I/B Score = 191 bits (103), Expect = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/Plus Query 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217 Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104 Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr4:81761404-82176981 bp, - strand). Nfib is member of protein family having diverged role in transcription and cell cycle regulation.Similarly BLAT analysis retrieves same gene against the query of given sequence.
Wednesday, November 20, 2019
Experiment or Quasi-Experiment Coursework Example | Topics and Well Written Essays - 250 words
Experiment or Quasi-Experiment - Coursework Example According to William M.K. Trochim, in this type of research design the most often used group is the intact groups which we think are similar as the treatment and control groups. Two significant characteristics of the NEGD are clearly manifested in this experiment. First, the sample group that is used in the experiment is practically similar in the sense that these kids all have high self-efficacy in playing softball. The second characteristic is the non-random manner of choosing the group. All the components of the group have high self-efficacy in playing softball. This clearly shows that the components of the group are not randomly picked. This experiment is definitely a quasi-experiment due to the fact that the selected group is considered without any random pre-selection process, and upon which a variable is tested. In addition, the result that is achieved of this experiment is used in generating results for general trending. Although this experiment is done for the measurement of social variables, this experiment uses the self-efficacy measurement which can actually be statistically analyzed and
Monday, November 18, 2019
Importance of Professionalising HRM in Hotel Industry Essay - 20
Importance of Professionalising HRM in Hotel Industry - Essay Example From this paper it is clear that each department requires personnel to operate and mange the different types of customers. Thus, there is a need for HRM in a hotel because every aspect in a hotel is concerned with handling people. A HRM professional can understand the needs and preferences of employees and can handle the employee related problems quite efficiently than others. From the provided case, it can be observed that it is a challenge for Happy Hotels to recruit, develop and maintain workforce which is significant for the hotel because a good motivated workforce is the key for providing high quality services to the sensitive customers. The approaches undertaken by Happy Hotels are quite different than the other high cost hotel services. It provides customers with excellent services, comfortable rooms, and good meals with minimal budget than other high cost hotel such as Premium Inn or Holiday Inn. Thus, the job description in Happy Hotels needs range of skills and qualities. The employees must have knowledge to interact with various customers who can impact the HRM strategies such as recruitment and training of employees. HRM can broadly manage the employees in Happy Hotels and can aid the hotels to pursue their path towards achieving success. There are many reasons for professionalising HRM in the expansion of hotel group. Every hotel seeks to dev elop their services which can differentiate them from other competitors. Thus, a hotel will always endeavour to focus on providing customers any product or service which is new and innovative. The employees of the hotels will play one of the major roles in fulfilling this endeavour of the hotels. Thus, the employees need to learn behaviour such as readiness to tolerate uncertainty and changeability. They need to take risks. A highly skilled HR individual can help to achieve high level of autonomy in a hotel.
Friday, November 15, 2019
Holiday Inn Strategic Management
Holiday Inn Strategic Management Management can be generally defined as a art and science of getting the things done from others. The previous definition explains that a manager plans and guides a particular work which is done by other people. In this assignment I will be discussing about different strategic management process. Strategic management process is one of the very important management process which are been used by different organisations. Strategy :- Strategy are the resources used by the managers to achieve long term objectives. In simple term, strategies are the ideas which are been used by the management. Strategic management : Strategic management is a conduct of drafting, implementing and evaluating cross functional decisions in enabling to achieve its long term objectives. There are different types of process involved in strategic management :- Marketing is accepted globally as a life blood of any organisation. In this analysis I felt that strategic management is at the same level as marketing which decides the future and prosperity of an organisation. Practicing the management of strategies is very crucial in the competitive world. Successful managers will have to know their business market situation and position and to implement the strategies when required. I kept these objectives in mind and invented some management qualities in myself while doing a research on this topic. I feel that I need more knowledge of the management practices. So in my research on strategic management I had a good understanding of strategic management and practices. Basically the concept of strategic management closely resembles elements of foresights; this means planning a head is a major element in the business. Strategic management is considered as a life blood of any organisation. This assignment on strategic management covers the change and development in the organisation. I have also understood that having a clear idea of strategic management is crucial in todays competitive business world. Companys now a days seek ways to achieve a competitive advantage with other players in the industry that they operate. The environment in which a company operates can provide circumstances where the outcomes may be positive or negative. Many organisational studies have presented numerous theories that help companies in taking new ways in dealing with their operations. Strategic management is one of those important management theories and process that has been employed constantly by any business to address their management and decision making needs. I have chosen Holiday Inn as an example to illustrate the adaptation of strategic management and its process. In this assignment I have written about how holiday inn hotels analyse and critically evaluate the organisation practice to solve the problem connected with implementing their strategies. Main body :- Now I will be giving a short history on Holiday Inn hotel. Kemmons Wilson initially came up with the idea after a family road trip to Washington, D.C., during which he was disappointed by the quality and consistency provided by the roadside motels of that era. The name Holiday Inn was given to the original hotel by his architect Eddie Bluestein as a joke, in reference to the Bing Crosby movie. In 1957, Wilson franchised the chain as Holiday Inn of America and it grew dramatically, following Wilsons original tenet that the properties should be standardized, clean, predictable, family-friendly and readily accessible to road travellers. By 1958, there were 50 locations across the country, 100 by 1959, 500 by 1964, and the 1000th Holiday Inn opened in San Antonio, Texas, in 1968. The chain dominated the motel market, leveraged its innovative Holidex reservation system, put considerable financial pressure on traditional hotels and set the standard for its competitors, like Ramada Inns, Quality Inn, Howard Johnsons, and Best Western. By June 1972, when Wilson was featured on the cover of Time magazine, there were over 1,400 Holiday Inn hotels worldwide. Innovations like the companys Holidome indoor pools turned many hotels into roadside resorts. The company later branched into other related enterprises, including Medi-Center nursing homes, Continental Trailways, Delta Queen and various related enterprises. Wilson also later developed the Orange Lake Resort and Country Club near Orlando and a chain called Wilson World Hotels. The family of founder Kemmons Wilson still operates hotels as part of the Kemmons Wilson Companies of Memphis. Wilson retired from Holiday Inn in 1979. Although still a healthy company, changing business conditions and demographics saw Holiday Inn lose its market dominance in the 1980s. Holiday Inns, Inc. was renamed Holiday Corporation in 1985 to reflect the growth of the companys brands, including Harrahs Entertainment, Embassy Suites Hotels, Crowne Plaza, Homewood Suites by Hilton and Hampton Inn. In 1988, Holiday Corporation was purchased by UK-based Bass PLC (the owners of the Bass beer brand), followed by the remaining domestic Holiday Inn hotels in 1990, when founder Wilson sold his interest, after which the hotel group was known as Holiday Inn Worldwide. The remainder of Holiday Corporation (including the Embassy Suites Hotels, Homewood Suites by Hilton and Hampton Inn brands) was spun off to shareholders as Promus Companies Incorporated. In 1991, Bass launched Holiday Inn Express, a complementary brand in the limited service segment. In 1994, Bass launched Crowne Plaza, a move into the upscale hotel market. In 1997, Bass cr eated and launched a new hotel brand, Staybridge Suites by Holiday Inn, entering the North American upscale extended stay market. In March 1998, Bass acquired the InterContinental brand, expanding into the luxury hotel market. In 2000, Bass sold its brewing assets (and the rights to the Bass name) and changed its name to Six Continents PLC. InterContinental Hotels Group (IHG) was created in 2003 after Six Continents split into two daughter companies: Mitchells Butlers PLC to handle restaurant assets, and IHG to focus on soft drinks and hotels, including the Holiday Inn brand. Business relationship with Gulf Oil In 1963, Holiday Inn signed a long-term deal with Gulf Oil Corporation in which the lodging chain would accept Gulf credit cards to charge food and lodging at all of its hotels (in the United States and Canada). In return, Gulf would build service stations on the premises of many Holiday Inn properties, particularly those along or near major U.S. and Interstate highways. Many older Holiday Inns locations (including some no longer part of the chain) still have the service station properties intact today, either still in operation or closed down. With the exception of a few locations in the eastern U.S., hardly any of the still-open stations are now Gulf outlets. The portion of the agreement which permitted Gulf credit cards to be used for payment of food and lodging at Holiday Inns was copied by competing lodging chains and major oil companies during the mid-to-late 1960s. Most of those agreements fizzled out with the 1973 oil crisis. The Gulf/Holiday Inn arrangement ended around 1982 . The brand name Holiday Inn is now owned by IHG, which in turn licenses the name to franchisees and third parties who operate hotels under management agreements. In January 2002, The Wall Street Journal reported that the company, led by Ravi Saligram, was producing a new 130-room Next Generation prototype hotel to rebuild the brand. It would include a bistro-like restaurant and an indoor pool. The first of these prototype hotels, the Holiday Inn Gwinnett Center, was built in Duluth, Georgia, in 2003. On 24 October 2007, IHG announced a worldwide relaunch of the Holiday Inn brand. The relaunch is focused on delivering consistently best in class service and physical quality levels, including a redesigned welcome experience and signature bedding and bathroom products The first relaunched Holiday Inn is expected to open in the USA in the spring of 2008. The whole relaunch process is planned to be complete by the end of 2010. In September 2008, IHG announced the creation of a new timeshare brand, Holiday Inn Club Vacations, a strategic alliance with The Family of Orange Lake Resorts. As told before strategic management is a set of activities undertaken in the order of time. One of the first tasks in strategic management is environmental analysis. Environmental analysis is the study of an organisations environment to pin point the environmental factors that can significantly influence the organisational operations. It provides a frame work for understanding an organisations environment with the aim of helping to find the key issues and different ways of coping up with the complexity and change. A business organisation operates in an external and internal environment. The factors which influencing the external environment is known as PESTEL. PESTEL stands for political factors, economical factors, social factors, technological factors, ecological factors and legal factors. Analysis:- The political, economical and social context stood as a big challenge for the organisation of Holiday Inn when they entered the market. the holiday inn operations are highly influenced by the policies set by the government in which ever territory or country they operate. Most of the Holiday Inn are controlled by regulations of operations and policies of individual properties. The Holiday Inn group will also focus on concerns such as health and safety employment, laws , worker protection and environment. From my studies I think all these elements are seen in the control of government that authorises licensing of hotels in different states. Being in a business environment they have to abide by the employment procedures and tax obligations where they operate. As the company is widely expanded and well developed they must co-operate with the practices set by political body. After my research I think this company should get full co-operation from the political power to succeed in local an d international market. as many private enterprise when holiday inn was opened the management had very informal sense of direction setting up a few long time goals without implementing proper strategy. How ever by implementing a new scenario in their strategy with set an international competitive advantage in hotel industry as tourist increased every where and the hotel accommodation was in demand after this the management of Holiday Inn realised the need and development of planning strategies. The management achieved a competitive advantage position and enhanced the holiday inn groups performance in relation to its competitor. Company have taken a very good advantage of this point and served this market segment all the time. They have given market what they want according to the expectations. I think by going through company history the Holiday Inn is spread all over the world. This vast expansion is because of its good economical stability. The company has its own concerns involving economic factors. The branches and franchise like Holiday Inn has the tendencies to experience the hard ships in instances where the economy of the respective countries is hit by inflation and changes in exchange rates. Because of the disposable income of the citizens in developed countries the holiday inn group gave prior importance in marketing their business because of the economic stability of these countries. Holiday Inn is a world wide chain and its international functional strategies will always yield profitable returns. The potential customers are from all over the world. It is been noted that the holiday inn company has given the market such as Europe, Asia, America with regards to their social-cultural needs. Holiday Inn, like all other hotels has established a good system in determining the needs of the market. The company uses the concept of product, personality, behaviour of the customer and purchasing to its advantage. Now I am going to talk about the technical factors influencing the company. This is because of the technical advancement due to which the company could reach in a very short span to many people about their various products and service information. Customers can contact Holiday Inn by many means such as emails, telephone, travel agents, website etc. holiday inn is providing their guests with all modern amenities and facilities to their rooms to provide the best accommodation experience. Their hotels all over are fully equipped with modern amenities and technical advancement. The above mentioned study helped me a lot to determine how much the elements of PESTEL were helpful and positive for the development of the company After the analysis of PESTEL and depending upon that outcome I have also carried out SWOT analysis of the company Holiday Inn which gives me exact position of the company in the market. SWOT stands for strength, weaknesses, opportunities and threats. These are the factors influencing the internal environment. SWOT analysis is extremely useful for understanding and decision making for all source of situation in business and organisation. It also provides a frame work for reviewing strategy position and direction of the company. I think it is therefore important to evaluate the environment opportunities in relation to the strengths and weaknesses of the organisation resources. Strengths: as mentioned in the history of the company it clearly states that the Holiday Inn Corporation is a well established organisation and industry leader in hospitality. Holiday Inn is well diversified hotels in the high end, business and mid priced classes in their product mix. Holiday Inn also poses a solid integration features such as owning the companies that manufacture its furniture and has invested in online reservation travel enterprises. It also has easy access to all its customers to get information and also has a excellent reservation system. Weaknesses: according to my research Holiday Inn may be narrowly focused making it susceptible to the down turn in the global economy and other world wide catastrophes that could limit global travel. Holiday inn hotels may also be venerable to employees strikes and crack down on undocumented workers. I think the aggressive expansion policies may put the company in trouble during the global down turn. Some of the branches or franchises do not follow the holiday inn set standards, recruitment process efficient accounting systems. Opportunities:- Holiday Inn corporation is a global pioneer in hospitality industry. Their position is strong financially and they are widely expanding all over the world. They offer an array of distinctive and specialised services to their guests. They also have an opportunity to expand or acquire a cruise line company. The holiday inn corporation should take advantage of emerging markets especially with business clients and mid priced markets. The holiday inn corporation has a strong affiliation with REIT (real estate investment trust) or similar organisation that provides a strong back up for hotels. It has a strong skilled work force all over. Threats: Like all other business, the major threat for holiday inn will be an emergence of a new competitor. The competitors will be more active in promoting the concept of global brand name. Holiday Inn has its own resources to sustain their global brand name. In general the hotel industry faces a threat from internet reservation channels which represents a growing share of hotel room booking. To overcome these threats Holiday Inn has its own centralised reservations system. Looking at strategic direction of the company the mission statement says GREAT HOTELS GUEST LOVE shows that holiday inn makes all efforts to exceed their customer expectation. This statement covers all aspects on hospitality firm in a brief manner. The vision statement and the values of the company states that year after year holiday inn (IHG) and the management will be regarded as the best and most sought hospitality group. From my personal experience while working with holiday inn group I can say that they are following their vision and mission statements. By observing their strategic formulation they have adopted cost leadership strategies. They are one of the lowest cost providers for their product. This makes many customers to become potential and loyal. They have targeted very broad market from high and society to middle and the lower one. While offering this wide variety of offers to the customers they have developed and achieved best value strategy. During my analysis on holiday inn I discovered the difficulties faced by them or in other words we can say their weakness. They faced great difficulties while entering the Asian markets. The reason behind this was they were not familiar with Asian market. To overcome this problem they had to take a strong action plan by signing a joint partnership with Asian hotel firms. This provided them a base to learn about the Asian environment and their establishment. Holiday Inns vision for the future was a property that delivers new levels of customer convenience by extending hotel systems for guest and employee access using the hotels wireless infrastructure. RECOMMENDATIONS :- From my analysis since holiday inn is expanding it is wise to deal with proper authorities in the respective markets where they intend to operate. The company has to accomplish and satisfy all the prerequisites for doing business. The company should also carry out a well conducted market research before penetrating the new segments of market. the company should always obtain relevant information from the target market in addition to the individual customers of organisation. A comprehensive market research is a must before granting a franchise. I think similar research should be made in areas like consumer behaviour and purchasing patterns of the market. Holiday Inn Corporation has to re-evaluate its internal environmental factors like Strengths, Weakness, Opportunities and threats to overcome with a strategic direction adjusting its mission and vision and at the same time maintaining its values. These are the few strategies that holiday inn must adopt to attract more diversified clie ntele. Therefore in order to survive and maintain the brand name holiday inn corporation should be consistent with their excellent service being always innovative. They should also create the role of middle managers and let them to be more innovative. I think the biggest challenge for Holiday Inn is expansion and franchises. The main features of Holiday Inn Corporation should be put as a standard one for the franchisers to follow. Will the franchisers really set the standards followed by Holiday Inn Corporation? What are the efforts that are to be put for the franchisers to follow the standards set by Holiday Inn Corporation? Holiday Inn is also using its technology to its advantage. The interactivity and the real time effects of communication is a good way to find suppliers. CONCLUSION :- Successful strategies always demand a company to choose the market in which their unique capabilities will gain competitive advantage. However the adoptive and incremental context of strategic management means that the company starting point leads the firm to a stable position. Corporate strategies of Holiday Inn have been able to use strategic management to stay in the competition in the global market. I believe that the strategies as well as the leadership styles used by the management of Holiday inn have been the major cause of their competitive position in the hotel market. Though Holiday Inn is considered as a leader in hospitality sector there is a need of flexibility. Slight changes in the market can effect their operations of the business. They should not rely on their past success but instead they should innovative and ready for any future uncertainties. Holiday Inn Corporation focuses on services rather than accommodation itself. I truly agree that the true asset of the organisation is the staff. The staff are the one who represent Holiday Inn hotels through their excellent services. So there is a need to make sure that the staff is always happy with the behavioural integrity of work place. The corporate strategy of Holiday Inn has been able to guide the company from challengers and opportunities that appears in the market environment in order to sustain the competitive advantage. Therefore I think the leaders of the company should continue their style to motivate their employees and become a major asset for the success of the company.
Wednesday, November 13, 2019
All Quite On The Western Front Essay -- essays research papers
ââ¬Å"All Quiet On The Western Frontâ⬠à à à à à à à à à à World War I was a fierce and very disturbing time for many people. During war people will stretch their own personal boundaries and limits just to stay alive. Although every solider was someoneââ¬â¢s son, by the end of the war this was not a factor. By thinking of an enemy as less then human, the act of killing someoneââ¬â¢s son was a little easier on the minds of each soldier. To everyday people it is apparent that the war changes people, but the extent of the change is not so easy to see. This change is symbolized in the movie, ââ¬Å"All Quiet On The Western Front.â⬠à à à à à At the beginning of the movie, Paul Baumer and his friends were excited about the war. Their teacher Mr. Kantorek, had put a theory in their heads that war was a patriotic duty. If you loved and wanted to support your country, then going to war was a must. With this theory in your head, the act of war is a very difficult thing to handle. Paul realized that war was a horrible place to be. Yes you were fighting for your country, but at the same time all of your friends and family were dying around you. In the end was it really worth it? This was the question that ended up on Paulââ¬â¢s mind, and was a question that would not be soon to leave his conscience. à à à à à Paul was a good boy. He had a good education, was a non-smoker, and had many friends. His teacher was amazed a...
Monday, November 11, 2019
Education in Pakistan Essay
President Asif Ali Zardari signed ââ¬ËThe Right to Free and Compulsory Education Bill 2012ââ¬â¢ into law. The bill, which sought to ensure all children between five to 1 6 years of age are provided free education. He urged provincial governments to promulgate similar legislations in their respective assemblies as well. He said the responsibility for providing free education rests with both federal and provincial governments, referring to article 25-A of the Constitution. The article 25-A of Constitution of Pakistan obligates the state to provide free and compulsory quality education to children of the age group 5 to 16 years. The federal government will now provide free textbooks and uniform s to children and ensure schools have qualified teachers. Free pre-school education, early childhood care and free medical and dental inspection will also be provided to all citizens and no child will be subjected to corporal punishment ââ¬Å"Under the law, private schools will be required to provide free education to disadvantaged students, who will comprise 10% of each class,â⬠Zardari said, adding that school management committees will be established to persuade parents into sending their children to schools. ââ¬Å"We will honor our international commitments and achieve the targets set by the Education for All and Millennium Development Goals initiatives. National Educational Policy 2009 Under the 18th constitutional amendment control and management of the education sector has been devolved to the provinces. They are now responsible for the key areas of the education sector i.e. curriculum and syllabus, centers of excellence, standards of education up to intermediate level (Grade 12) and Islamic education. Planning and policy and standards of education beyond Grade 12 are covered under Federal Legislative List. All the provinces have shown their commitment to the National Education Policy 2009. The National Educational Policy (NEP) 2009 is a milestone which aims to address a number of issues including: * Quality and quantity in schools and college education * Universal primary education * Improved Early Children Education (ECE) * Improved facilities in primary schools * Converting primary schools to elementary schools * Detaching classes XI-XII from college education * Adopting a comprehensive definition of ââ¬Ëfree ââ¬Ëeducation * Achieving regional and gender parity especially at elementary level the share of resources for education in both public and private sectors Accordingto the latest Pakistan Social and Living StandardsMeasurement (PSLM) Survey 2010-11, the literacyrate for the population (10 years and above) is 58percent during 2010-11,
Friday, November 8, 2019
computer literacy
computer literacy The Impact of Mobile Computing Running head: the impact of mobile computing 1the impact of mobile computing 9The Impact of Mobile ComputingDorothy AshfordINFO 103 Computer LiteracyInstructor Sabahudin TricicAugust 14, 2014The advancement of technology has made it possible to have access a computer and the internet, anywhere. Internet access was once limited to home, office, or school. That is a thing of the past. We can access a computer and the internet through mobile computing. Most of our everyday lives depend on some type of mobile device. This article explores the impact of mobile computing. How much has mobile computing affected our daily lives as students, professionals, and kids?According to the author Bowles, there are hundreds of thousands of apps that programmers designed especially for mobile devices. For example, location-based services, provide the user information based on their location, social networking, sharing information with friends (like Facebook, Twitter, and Instagram), mobile search, help people search for information based on their location, such as asking a smartphone to tell the user where the nearest pizza shop is and mobile commerce lets users check into a store they are physically at to gain special information about products.The study of photography is one field in which it's easy to find out the impact computers have on our daily lives. Thanks to digital cameras, anyone can shoot, develop, and publish photographs. No particular skills or equipment are required. This is good for people who want to share pictures on Facebook or Instagram. For people who use photos for business purposes, digital photography can present ethical issues. There are two areas of concern: adherence to copyright laws and ethical concerns regarding alteration of photographic images. "Copyright laws give people who create content-such as books, movies, music, or photographs-ownership rights to that content.Created by the previous uploader using a popular O...As I have pointed out elsewh ere (Besser 1988), polls of computer use indicated that the people buying them weren't quite sure what kind of new or interesting use they would put these to. Just as people continued to buy computers for reasons other than a clearly demonstrated utilitarian function, forces continued to press for computer education in the schools without any kind of clear demonstration of how this would make students into better functioning members of our society.The pressure for "computer literacy" did not come from some clear and pressing need for "good citizens" to have to know about these machines. Rather, this movement came from the traditional forces which had shaped public education since its very beginnings. In this chapter we will see how the corporate need for a trained workforce and the competitive need to keep America ahead of other countries economically and...
Wednesday, November 6, 2019
History of Ice Cream
History of Ice Cream The origins of ice cream can be traced back to at least the 4th century BCE. Early references include the Roman emperor Nero (37-68 CE) who ordered ice to be brought from the mountains and combined with fruit toppings, and King Tang (618-97 CE) of Shang, China who had a method of creating ice and milk concoctions. Ice cream was likely brought from China back to Europe. Over time, recipes for ices, sherbets, and milk ices evolved and served in the fashionable Italian and French royal courts. After the dessert was imported to the United States, it was served by several famous Americans. George Washington and Thomas Jefferson served it to their guests. In 1700, Governor Bladen of Maryland was recorded as having served it to his guests. In 1774, a London caterer named Philip Lenzi announced in a New York newspaper that he would be offering for sale various confections, including ice cream. Dolly Madison served it in 1812. First Ice Cream Parlor in America - Origins of Name The first ice cream parlor in America opened in New York City in 1776. American colonists were the first to use the term ice cream. The name came from the phrase iced cream that was similar to iced tea. The name was later abbreviated to ice cream the name we know today. Methods and Technology Whoever invented the method of using ice mixed with salt to lower and control the temperature of ice cream ingredients during its making provided a major breakthrough in ice cream technology. Also important was the invention of the wooden bucket freezer with rotary paddles, which improved the manufacture of ice cream. Augustus Jackson, a confectioner from Philadelphia, created new recipes for making ice cream in 1832. Nancy Johnson and William Young - Hand-Cranked Freezers In 1846, Nancy Johnson patented a hand-cranked freezer that established the basic method of making ice cream still used today. William Young patented the similar Johnson Patent Ice-Cream Freezer in 1848. Jacob Fussell - Commercial Production In 1851, Jacob Fussell in Baltimore established the first large-scale commercial ice cream plant. Alfred Cralle patented an ice cream mold and scooper used to serve on February 2 1897. Mechanical Refrigeration The treat became both distributable and profitable with the introduction of mechanical refrigeration. The ice cream shop or soda fountain has since become an icon of American culture. Continuous Process Freezer Around 1926, the first commercially successful continuous process freezer for ice cream was invented by Clarence Vogt. The Ice Cream Sundae Historians argue over the originator of the ice cream sundae but three historical probabilities are the most popular Ice Cream Cones The walk-away edible cone made its American debut at the 1904 St. Louis Worlds Fair. Soft Ice Cream British chemists discovered a method of doubling the amount of air in ice cream creating soft ice cream. Eskimo Pie The idea for the Eskimo Pie bar was created by Chris Nelson, an ice cream shop owner from Onawa, Iowa. He thought up the idea in the spring of 1920 after he saw a young customer called Douglas Ressenden having difficulty choosing between ordering an ice cream sandwich and a chocolate bar. Nelson created the solution, a chocolate covered ice cream bar. The first Eskimo Pie chocolate covered ice cream bar on a stick was created in 1934.ââ¬â¹ Originally Eskimo Pie was called the I-Scream-Bar. Between 1988 and 1991, Eskimo Pie introduced an aspartame-sweetened, chocolate-covered, frozen dairy dessert bar called the Eskimo Pie No Sugar Added Reduced Fat Ice Cream Bar. Haagen-Dazs Reuben Mattus invented Haagen-Dazs in 1960, He chose the name because it sounded Danish. DoveBar The DoveBar was invented by Leo Stefanos. Good Humor Ice Cream Bar In 1920, Harry Burt invented the Good Humor Ice Cream Bar and patented it in 1923. Burt sold his Good Humor bars from a fleet of white trucks equipped with bells and uniformed drivers.
Monday, November 4, 2019
Given that users prefer redress mechanisms to be independent, what Essay
Given that users prefer redress mechanisms to be independent, what justifications explain why some parts of redress mechanism are independent and others are not - Essay Example A good example is the tribunals that are managed by independent tribunals that automatically have to be independent. This is for the reason that they function in a quasi-judicial approach that needs no influence from other forces. These tribunals would, therefore, make it easier for implementation of policies of the tribunals. The Ombudsmen services are yet other independent bodies2. They are run under the leadership of independent Ombudsmen, mostly referred to as commissioners. These bodies need to be independent for the reason that they are charged with the responsibility of investigating various complaints from the citizens. In the case of poor administration, or even offering of poor services to the citizens, these organizations ought to operate independently, if the results have to be free and fair. The Parliamentary and Health Services Ombudsman Offices are the most common in
Saturday, November 2, 2019
Consider the functions of directors,company secretaries, auditors and Essay - 1
Consider the functions of directors,company secretaries, auditors and shareholders. In what ways do they contribute to the operation of both private and public limited companies - Essay Example Therefore the given essay analyses the role of all these four groups of actors (directors, company secretaries, auditors and shareholders) in order to demonstrate the importance of each of them in operation of both private and public companies. Firstly, directors are the key actors for the companyââ¬â¢s performance on market. In general, they are important because they create the policy of the company (Osemeke, 2014). In the circumstances of either private or public limited company, this role changes only slightly. In fact, private company may have sole director, while public limited company needs two or more directors (Rosenfalck, 2013). In addition, Directors Board becomes the only significant representative, if there is no existing controlling stakeholder in the company (Davies, 2010). Frequently, this situation appears in private companies (Rosenfalck, 2013). Furthermore, the directors of the company are trained to act their instructions or directions. For example, when there is a serious loss in capital of public company, directors have to gather an extraordinary general meeting not later than 56 days from the day of half or less capital reduction (Rosenfalck, 2013). According to Osemeke, (2014), failures and bankr uptcies of the company are mostly to result an ineffective directors board. In this context, ineffective work of the board has been shown in a recent failures of big companies like Enron and HIH (Convill and Bagaric, 2004). Moreover, Davies (2010) said that directors should care and promote the companyââ¬â¢s success and do independent actions. In fact, directors of public companies must be sure that they hire competent company secretary (Rosenfalck, 2013). Among the main flaws of directors that have a direct effect on the companyââ¬â¢s performance, according to Osemeke (2014) ââ¬Å"lack of training and induction
Subscribe to:
Posts (Atom)