Antitrust Practices and Market Power Essay - 835 Words

Title page Antitrust Practices and Market Power Melissa Carey Melissa_C06@hotmail.com Content Introduction†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.........page 2 Investigation †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ page 2 Costs and Antitrust Act†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.page 2-3 Monopolies Bad for Society†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦....... page 3-4 Conclusion†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.......... page 4 References†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦...... page 5 Antitrust Practices and Market Power Introduction This paper will discuss the antitrust law, specifically the Sherman Act of 1870. A claim was filed against the NCAA by the Governor of Pennsylvania for reasons that violate this act. It will also discuss monopolies and oligopolies,†¦show more content†¦He claims that this power, or monopolization has caused the NCAA to threaten Penn State with the suspension of their football team altogether, which then lead to Penn State agreeing to the violations and accepting the â€Å"drastic but less painful sanctions† (citation) in order to hold onto some of their reputation. The costs that are associated with this specific case are mainly targeted to the amount that Penn State’s football program generates annually. It has been claimed that Penn State impacts about â€Å"161.5 million statewide† not to mention the â€Å"$90million economic impact in Centre County alone† (Miller, 2013). James D. Schultz, Corbetts general counsel also stated that more than 2,000 jobs were also supported by this program; this alone is why the antitrust claim was investigated, due to the affect on Pennsylvania’s economy and on the citizens as a whole. Monopolies Bad for Society? After the proper amount of research, having monopolies and oligopolies are not always bad for our society. Sometimes they can provide the stability that our government and economy needs in order to create a low enough cost for production and overall beneficial. For example, most utilities are considered to be a positive monopoly. Electric and gas companies in particular are beneficial in having the government regulate the prices so that each individual would not have to be in charge of having their own generators or source of electricity that wouldShow MoreRelatedAntitrust Practices and Market Power1366 Words   |  6 PagesAntitrust Practices and Market Power Introduction The purpose of this paper is to look into a case of antitrust behavior being investigated involving Johnson and Johnson and Novartis AG, and to analyze and discuss the various antitrust practices that the organizations involved are accused of utilizing. Its purpose is also to discuss how the practices being deployed in this scenario can help any of the organizations to secure market power, which is defined by the ability of a firm toRead MoreAntitrust Practices and Market Power500 Words   |  2 PagesAntitrust Practices and Market Power Apple was investigated and subsequently ruled against in United States District Court giving the US Justice Department an antitrust victory. The case alleged Apple had colluded with five major publishers to fix the prices of electronic books (e-books). In 2010 Apple introduced an in which the publishers set retail prices in return for a commission paid to Apple. The publishers were under a contract which said in the price of an e-book available through Apple’sRead MoreAntitrust Laws And The Federal Branch Of The United States Government1128 Words   |  5 PagesThe role of antitrust laws has been the subject of numerous publications that have attempted to provide a precise set of reasons and inspirations for their creation. However, there are still many schools of thought on the subject and much debate over the effectiveness and legitimate implementation of these laws. This paper analyzes the three main antitrust laws that the federal branch of the United States government u ses to try to restrict monopolies. This paper also looks at antitrust laws in theRead MoreAntitrust Law Violation Of Antitrust Laws1277 Words   |  6 PagesAntitrust Law Violations Introduction This paper will discuss the Google case that was presented by Microsoft stating that Google was in violation of antitrust laws. Also, in this paper some of the pecuniary and non-pecuniary costs will be discussed. Given in this paper will also be my thoughts on monopolies and oligopolies. Antitrust Case Google was investigated for antitrust behavior because they were claimed to be an â€Å"internet bully that abuses its dominance of online search and advertising†Read MoreGovt Regulation in Private Sector1536 Words   |  7 Pagesform of taxes. The private sector can be referred to as a market. Markets operate by themselves and allocate resources efficiently, but theyre not perfect. Government regulation of the private sector is justified under two circumstances: when flaws appear in the market place that produce undesirable consequences and when adequate social, political, and other government regulation exists. When functioning perfectly, the competitive market determines which of societys resources can be used mostRead MoreAnti-Trust Practices and Market Power Essay775 Words   |  4 PagesTitle page FTC’s Google Antitrust Investigation ABC XYZ abcxyz@abcxyz.com Content Abstract†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦. 2 Introduction†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦... 2 Is search giant Google too dominant? †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦. 3 Effect of monopoly and oligopoly on Society †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦...†¦.†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦. 4 Conclusion†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦......... 4 References†¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦......... 4 FTC’s Google Antitrust Investigation Abstract Antitrust Policy consists of lawsRead MoreThe Antitrust Laws Are Really Competition Laws That Are Aimed At Protecting The Consumers From Predatory Businesses1132 Words   |  5 PagesQuestion #1 The antitrust laws are basically competition laws that are aimed at protecting the consumers from predatory businesses out who may be out to defraud consumer and to limit the practice of free and fair competition in the market. The major objective of these laws was majorly meant to curb business practise vices such as price-fixing, bid-rigging, and market allocations. In USA, the antitrust law is cascade into two major categories, the federal antitrust laws, and state antitrust laws. The firstRead MoreMicrosoft: An Examination of Monopolies1023 Words   |  4 Pagesviolating the Sherman Antitrust Act and the terms of a previous settlement by bundling its Internet Explorer browser application with its Windows operating system. The Sherman Anti-Trust Act was passed in 1890 in an effort to prevent monopolies that would threaten competition in the marketplace and would eventually lead to extortionary prices for consumers. The Act restricts companies from any practices that artificially create a monopoly by barring competitors from entering the market. The governmentsRead MoreThe Ethics Of The Antitrust Laws Essay1384 Words   |  6 PagesReview Article on the purpose of the antitrust laws is to protect and support free competition Dr Gaurav Khanna, - Associate Professor, Madhav University, Rajasthan, India. Dr. Deepak Bhandari - Professor, FDDI, Jodhpur, Rajasthan, India. Abstract: As per review on many journal, articles and bylaws we come to know that it is not an alternate for sound lawful guidance and does not take the place of knowledgeable lawful counsel required in analyzing exact problems. Competition strategy encroaches aheadRead MoreThe Between Germany And France840 Words   |  4 Pagesthe economic market economy or â€Å"laissez-faire†, where there is a free economic system in which the government does not intervene in the functioning of the economy (Bamford and Grant, 2011, p.26). Yet, we see that these countries actually intervene and regulate many aspects of the economy not only in the public sector but also on the private sector (in practice using a mixed economy approach). This is done to ensure (1) the establishment of perfect markets and a balanced division of power between consumers

Sylvia Plaths Poem Mirror - 1978 Words

Mirror In today’s day and age, it seems that some would do anything to erase a crease in their forehead, or a crinkle on the outskirts of an eye. Because time is something that we can never get back, growing older is an idea that many try to deny, especially in today’s society. Told from a mirror’s point of view, the mirror in the poem witnesses the truth of what it means to age. Sylvia Plath’s poem, Mirror, is a poem that deals with the truths and lies in the struggle a woman goes through when grasping the reality of aging. The poem is appealing due to the ways in which Plath successfully uses personification, figurative language, and diction in her writing to emphasize this idea, as well how the concept of keeping up appearances and†¦show more content†¦As the woman has aged, she no longer likes what she sees in the reflection of the mirror, and although it is the cruel reality of life, Plath’s metaphor of a mirror being a lake can be appreciate d because to look inside one’s soul is of essence in deciphering who one is. Another metaphor that can be found in the poem starts on line 12 when the mirror states, â€Å"Then she turns to those liars, the candles or the moon† (12). This use of figurative language of the poem addresses how growing old can be disguised for some time. The light that surrounds both candles and the moon is typically either dim or completely dark. Shedding light upon a subject means to shed light upon the truth and to see everything for what it truly is. If one chooses to stay in the dark, one objects him or her self to be sheltered from reality, just as the elderly woman shelters herself from the reality of aging. This metaphor can be appreciated because here again, Plath’s poem relates to today’s culture. Women especially seem to fear growing old. In order to counteract any signs of aging, many women turn to anti aging creams, or even the occasional (or not so occasional in some cases) Botox injection. Just like the liars, the candle and the moon, these rem edies only trick women into thinking they’ve defeated time itself and are still able to grasp onto their youthful appearance. Plath’s comparison of candle and moonlight to liars is genius. TheShow MoreRelatedPoetry Explication of Sylvia Plath’s â€Å"Mirror†949 Words   |  4 PagesPoetry Explication of Sylvia Plath’s â€Å"Mirror† The first thing one can notice in Sylvia Plath’s poem â€Å"Mirror† (rpt. In Thomas R. Arp and Greg Johnson, Perrine’s Literature: Structure, Sound, and Sense, 9th ed. [Boston: Wadsworth, 2006] 680) is that the speaker in the poem is the mirror and the woman in the poem is Sylvia Plath. As you read through the poem, the lake is relevant because of the famous mythological story of narcissus. He was extremely beautiful and one day while drinking from a lakeRead MoreA Reflection in Sylvia Plaths Mirror1013 Words   |  5 PagesA Reflection in Sylvia Plath’s Mirror Amanda L. Wilson Eng:125 Introduction to Literature Professor Lyndsey Lefebvre November 18, 2013 A Reflection in Sylvia Plath’s Mirror Sylvia Plath’s poem Mirror (1963) is evocative, provocative, and expressive. According to Clugston (2010) these are important components of poetry. Sylvia Plath’s first line is a projection of the mirror providing its introduction saying, â€Å"I am silver and exact†(Plath, 1963, line 1). The mirror is the protagonist whoRead MoreSylvia Plath is an American Writer who Writes Confessional Poems about her Life1117 Words   |  4 PagesSylvia Plath is an American writer, commonly known for her poetry works. Her poetry can be categorized as â€Å"confessional poetry†, which are poems about the poet’s personal life. Her two most famous published collections of poems are The Colossus and Other Poemsand Ariel, but it was not until after Plath’s death that The Bell Jarwas published. The Bell Jar is considered a more personal and semi-autobiographical novel. Throughout Sylvia Plath’s lifetime, she suffered mentally since she was a littleRe ad MoreThe Life Of Sylvia Plath Essay1313 Words   |  6 PagesThe Life of Sylvia Plath Sylvia Plath was a very dedicated author who lived from 1932-1963. She is best known for her poetry. Plath started writing and was a published poet at a very young age. According to Encyclopedia Britannica, Plath’s first poem was published when she was eight years old. â€Å"Plath’s poems explore her own mental anguish, her troubled marriage to fellow poet Ted Hughes, her unresolved conflicts with her parents, and her own vision of herself†(Poetry Foundation). Plath was a devotedRead MoreSylvia Plath s The Ideas Of Death, Quarrel, And Firsthand Encounters1590 Words   |  7 Pagesbut to others it is the entryway to a world of beauty and justice. In Sylvia Plath’s work the ideas of death, quarrel, and firsthand encounters are all vital contributions that work to develop Plath’s view on suicide and its ability to liberate her from the hindrances of life. Death makes it possible to attain sovereignty where her mind could release itself from its physic al imprisonment such as the ones portrayed in her poems. Suicide is what makes people feelRead MoreMirrors by Sylvia Plath967 Words   |  4 Pages13th March, 2014 In the poem â€Å"Mirrors†, by Sylvia Plath the speaker accentuates the importance of looks as an aging woman brawls with her inner and outward appearance. Employing an instance of self refection, the speaker shifts to a lake and describes the discrepancies between inevitable old age and zealous youth. By means of sight and personification, shifts and metaphors, the orator initiates the change in appearance which relies on an individual’s decision to embrace and reject it. Read MoreLiterary Analysis Of Sylvia Plaths Mirror1075 Words   |  5 Pagesto talk about in public and shows how much a situations can impact you. These events create emotions into art. Sylvia Plath’s story and motive to write poems begins around the same time her father passes, an event that will impact her poetry deeply. A little after Plath’s eighth birthday her father dies from a case of diabetes that he ignores to treat. Plath published one of her first poems at the early age of eight in the children’s section of the Boston Herald. Later, in 1950, she is accepted byRead MoreAnalysis of Sylvia Plaths Mirror1281 Words   |  6 Pagesï » ¿Analysis of Sylvia Plath’s â€Å"Mirror† Sylvia Plath is known as the poet of confession. Her life is strongly connected to her works. She uses poetry as a way to confess her feelings, to express and release her pain in life. â€Å"Mirror† is one of her most famous poems. Sylvia Plath wrote the poem in 1961, just two years before her actual suicide. After suffering a miscarriage, she realized that she was pregnant again. She and her husband moved to a small town and their marriage began going worse. The poem is notRead More##xiety In Courage, Gwendolyn BrooksThe Explorer, And Frederick Douglass732 Words   |  3 PagesAll poetry has a different theme that it focuses on, or does it? In these four poems, there is a strong sense of social anxiety, and then the overcoming of that with courage. In Sylvia Plaths Mirror, Anne Sexton’s Courage, Gwendolyn Brooks’ The Explorer, and Robert Hayden’s Frederick Douglass there is a strongly shared theme. To start off is the theme of social anxiety in Sylvia Plath’s Mirror. This poem is about a mirror that spends most of it’s days reflecting the wall, but occasionally, it is theRead MoreBiography of Sylvia Plath942 Words   |  4 Pagestwentieth century, Sylvia Plath was highly esteemed by fans and fellow writers alike. Sylvia Plath’s parents, Aurelia Schober and Otto Plath, had met when Aurelia became Otto’s student at Boston University. Otto was a biology professor with an infatuation with bees; he had even published a book titled Bumblebees and their ways. Otto and Aurelia married in January of 1932, and by October of the same year Aurelia gave birth in Jamaica Plain, Massachusetts to a daughter, Sylvia. Sylvia spent her childhood

American Quail Free Essays

In Europe, it refers to several kinds of game birds of the pheasant family. A brood may include from 10 to 18 eggs or more. Bold face markings and tilting crests identify the males from the females. We will write a custom essay sample on American Quail or any similar topic only for you Order Now Their feathers usually are slate blue, olive-brown, and black and white. Other kinds of American quail are the California quail, Gambles quail, mountain quail, scaled quail and mearn`s quail. These small plump quail prefer open woodlands, chaparral and grassy valleys. Hunters have killed so many of these birds that many states have hunting laws to protect them. Quails scatter at the approach of an enemy. Then they sound a gathering call. Bird authorities believe quail gather together this way. In Europe, it refers to several kinds of game birds of the pheasant family. A brood may include from 10 to 18 eggs or more. Bold face markings and tilting crests identify the males from the females. Their feathers usually are slate blue, olive-brown, and black and white. Other kinds of American quail are the California quail, Gambles quail, mountain quail, scaled quail and mearn`s quail. These small plump quail prefer open woodlands, chaparral and grassy valleys. Hunters have killed so many of these birds that many states have hunting laws to protect them. Quails scatter at the approach of an enemy. Then they sound a gathering call. Bird authorities believe quail gather together this way. In Europe, it refers to several kinds of game birds of the pheasant family. A brood may include from 10 to 18 eggs or more. Bold face markings and tilting crests identify the males from the females. Their feathers usually are slate blue, olive-brown, and black and white. Other kinds of American quail are the California quail, Gambles quail, mountain quail, scaled quail and mearn`s quail. These small plump quail prefer open woodlands, chaparral and grassy valleys. Hunters have killed so many of these birds that many states have hunting laws to protect them. Quails scatter at the approach of an enemy. Then they sound a gathering call. Bird authorities believe quail gather together this way. In Europe, it refers to several kinds of game birds of the pheasant family. A brood may include from 10 to 18 eggs or more. Bold face markings and tilting crests identify the males from the females. Their feathers usually are slate blue, olive-brown, and black and white. Other kinds of American quail are the California quail, Gambles quail, mountain quail, scaled quail and mearn`s quail. These small plump quail prefer open woodlands, chaparral and grassy valleys. Hunters have killed so many of these birds that many states have hunting laws to protect them. Quails scatter at the approach of an enemy. Then they sound a gathering call. Bird authorities believe quail gather together this way. Doug Ose was born in Sacramento on June 27, 1955. He graduated from Sacramento’s Rio Americano High School. Then went on to earn a Bachelor of Science in Business Administration from the University of California at Berkley in 1977. Doug worked in his family†s business, Ose Properties, for eight years as project manager. There he was responsible for developing three sub-divisions of approximately 273 residential lots in Sac and Roseville. He started his own real estate development and investment company in 1985. It specialized in mini-storage development projects. Today, Doug is recognized as an expert in mini-storage facility development. Doug and his wife, Lynnda, have two daughters, Erika and Emily. He has been a member of the Board of Directors for the California State Automobile Association, the Board of Directors for the Citrus Heights Chamber of Commerce, and the Sacramento Housing and Redevelopment Commission. Doug also served on the Citrus Heights Incorporation Project, where he was a leading force in the drive to incorporate the City of Citrus Heights in Sacramento County. On Nov.3 98, Ose was elected to the u.s. house of reps. He represents California’s Third Congressional District, which includes Yolo, Sutter, Glenn, and Tehama Counties as well as portions of Sac, Solano, and Butte Counties. In the 106th Congress, Congressman Ose serves on three committees: Agriculture, Banking and Financial Services, and Government Reform. Sub committees include: general farm commodities, resource conservation, and credit/risk management, research, and specialty crops, Banking and financial Services: sub committee: domestic and international monetary policy, and Government Reform sub committees: criminal justice, drug policy and human resources/ government management, info and tech. This was a hard paper for me. I waited too long to start and could not find much information. Next time I†ll work harder to get my assignments done to my full ability. Anyways, I went to search on AOL, Net Explorer, and the Doug Ose website. How to cite American Quail, Essay examples

Management Of Information Technology Planning †MyAssignmenthelp.com

Question: Discuss about the Management Of Information Technology. Answer: Introduction PMBOK stands for the Project Management Body of Knowledge which represents an exclusive description of the summing up of knowledge of the profession in project management of an organization. Since this is an emerging profession the primary concept is to accept PMBOK in organization (Annarelli and Nonino 2016). PMBOK provides and helps to promote the common vocabulary along with the profession of project management that discusses, writes and applies the concepts. It is quite essential for the professional discipline to keep then standard vocabulary of the project management assessments. This concept guides and also identifies the subsets of the project management body for good practice in the organization. In this report we are going to discuss, compare and contrast the response of twpo renowned organizations aspect of using project management and thus know about their IS Planning/Strategy in return. Organization 1: YarrA council YarrA council has been interviewed and as per the questionnaires the organization uses the PMBOKs methodologies. This strategies has been implemented yearly basis and strategic plans for IS starts about 12 to ends in 24 months. The IT managers describes that the organization business system that they use are TT Global RG, which is closely related to business system, otherwise they are known to have a data base server which are been separated from real time processing. The specialized officer continually counsels with the specialized help group and in addition the higher administration to decide the business and specialized objectives and get ready complete plans. As this is a Council, assessment of the IS panning achievement, absolutely relies upon the objectives accomplish by the association. The organization processes the IS arranging accomplishment with the vital objective of the association. Organization 2: Telenor In Telenor does not use the PMBOKs strategies for their organization. They use the traditional strategies mainly. As per the IT manager who has been interviewed IS Planning is the Sub Part of Strategic Plan which is normally formed for 3 5 Years. Though, in order to achieve the strategic Goals Planning Starts at-least one year ahead. Information system is critical for the business. Being that as it may, its significance is by and large not saw completely thus it isn't accentuated enough. Business misfortunes ought to be evaluated as an outcome of theoretical/reproduced/real security ruptures. By questioning the managers on how they are going to evaluate their success plan in the IS planning, the response were by analyzing User satisfaction, Lost productivity and Audit results. An Audit Review Committee guarantees that all Plans are being actualized and all controls are set up and being taken after. It comprises of checking on the controls and tests and guaranteeing neighborhood and friends' polices consistence to be coordinated from gathering. Comparison and Conclusion In organization 1: YarrA council, we can see that the association has the structure which is as far as making the framework further developed as far as making the framework further developed as far as making the foundation of the association. The fundamental thought of making the progressed infrastructure is to influence the association to prepare for the circumstances which it might look later on. Making the framework further developed as far as making the framework. The fundamental thought of making the framework in the skirt of accomplishment it is vital to make the full confirmation arranging which is likewise imperative from the perspective of the entire framework (Hornstein 2015). The fundamental thought of making such association is to make the essential standards in a very much coordinated way. The primary thought of making such critical components which is additionally imperative for the improvement of the association, are composed from the administration perspective. The fo undation of making such imperative factor is to make the diagram of the framework which is additionally done keeping in mind the end goal to make the framework further developed as for the principle learning of the framework (Larsen, Manning and Pedersen 2013). There are a few components which are additionally numerous imperative principles of utilization and the essential thought of making the framework is to ensure that the association can likewise make the framework further developed as far as making the foundation and the business angles from the perspective of the expert of the association. The essential impression the customers get from the foundation is gotten from the possibility of the framework and the fundamental thought of getting the information of making the framework further developed as far as making the framework and the issue of utilizing the association is to make the framework and the essential thought of utilizing the framework position of utilizing the framework and the framework which is additionally vital from the perspective further developed regarding the framework and making such framework is to make the fundamental learning of the framework which is likewise identified with the stream of the principle creation li ne of the framework (Mubarak 2015). The fundamental favorable position of utilizing the framework is to make the framework metal progressed as far as the framework and the principle preferred standpoint of utilizing the framework is to make and make the framework further developed. In organization 2: Telenor, the IS plannings main concern is that this organization can make the system much activated and advancing in order to outline the functionality of the organization. The main concept of the planning is to create the goal with respect to the principle of the organization depending on the amount of the resources the organization can support are constantly extraordinary sorts of viewpoints for the organization keeping in mind the end goal to amend the shortcoming and the extent of further progressions (Barak 2016). The primary progression of the framework is to make the framework all the more effective as far as profitability and the fundamental favourable position of making the framework more exact in nature the administration of the association ought to dependably be exceptionally dynamic with a specific end goal to make the circumstance if the organization adaptable. The essential work of the administration is to make an appropriate guideline or getting read y for the organization. The main benefit to make the system much more advanced and in order to make the planning is basically to give a clear and transparent overview of the objectives and the ideas that the management and higher authorities of the company. This is done to convey the employees of the organization the aspect of living in the organization (Larsen, Manning and Pedersen 2013). There are a few capacities which can be viably finished with the assistance of legitimate arranging and the primary headway of utilizing the arranging is to make a portal to the framework which can simply give the answer for the different sorts of the issues, the fundamental thought identified with the framework is to make the principle layout for the capacity which is to be done The principle thought identified with the framework is to characterize the issues identified with the framework and the fundamental thought of characterizing the arranging is to discover the few reason s which are really make the arranging, the f undamental issues would then be able to just simple to be corrected when those are effectively characterized (Morgan et al.,2015). The subsequent stage of arranging is to recognize hazardous factors that may harm the profitability in some ways. There exist a few hazard factors that can be painful for the association and its profitability. The essential thought of making a full confirmation arranging is to recognize and figured all the conceivable hazard factors for the organization. The fundamental thought to make the framework further developed as far as making the framework. Conclusion There are many sorts of organizations and each of those requires appropriate arranging and course of action to make the entire working fruitful. In an association there are numerous solid and also frail issues which are to be investigated keeping in mind the end goal to get the most ideal outcome for the framework. The fundamental thought in regards to the framework is to make the entire framework in such a path in this way, to the point that the association makes the best possible arranging and it is likewise vital to make the framework further developed as for the few variables which are additionally vital for the headway of the association. From the above discussion it can be concluded that the association can make a few progressions in different offices as indicated by the principle headway of the association and it is additionally fundamental for the association to make the circumstance further developed regarding making the framework effective as far as making the framework further developed. In this report the dialog of a few parts of two associations are given as for the meeting taken from the leader of the division of the association. From the meeting which has been conducted with the IT managers of the we can understand that the primary thought is the association can make the framework further developed as far as a few generation line and usefulness. References Annarelli, A., and Nonino, F. (2016). Strategic and operational management of organizational resilience: Current state of research and future directions. Omega, 62, 1-18. Barak, G. (2016). Alternatives to high-risk securities fraud control: proposing a structural transformation in an age of financial expansionism and unsustainable global capital. Crime, Law and Social Change, 66(2), 131-145. Brones, F., de Carvalho, M. M., and de Senzi Zancul, E. (2014). Ecodesign in project management: a missing link for the integration of sustainability in product development?. Journal of Cleaner Production, 80, 106-118. Brown, T. (2016). Engineering economics and economic design for process engineers. CRC press. Hornstein, H. A. (2015). The integration of project management and organizational change management is now a necessity. International Journal of Project Management, 33(2), 291-298. Kerzner, H. (2013). Project management: a systems approach to planning, scheduling, and controlling. John Wiley Sons. Larsen, M. M., Manning, S., and Pedersen, T. (2013). Uncovering the hidden costs of offshoring: The interplay of complexity, organizational design, and experience. Strategic Management Journal, 34(5), 533-552. Leach, L. P. (2014). Critical chain project management. Artech House. Morgan, A., Isaac, M., Scrutton, S., Wedgewood, J., Jankowska, P., and Hwang, D. (2015). EP-1572: Using a commercial software package to support treatment planning peer review in small radiotherapy departments. Radiotherapy and Oncology, 115, S860. Mubarak, S. A. (2015). Construction project scheduling and control. John Wiley Sons. Naber, A. (2017). Resource-constrained project scheduling with flexible resource profiles in continuous time. Computers Operations Research, 84, 33-45. Walker, A. (2015). Project management in construction. John Wiley Sons.

Summarise Key Aspects of Legislation free essay sample

In order to keep up with the changes, I need to ensure that I meet the highest possible standards. Following this, I must be committed to my own professional learning, seeking to expand my skills and to deepen my knowledge as a teacher. Now I’m going to say a few words about some of the most important legislations that comply with in order to become a good teacher. Calin Rusu Confidentiality and Data protection Act (1998) are very important legislations for a teacher being linked to the Domains A and E from LLUK standards. Learners expect us to respect and protect confidentiality. This duty extends to any information relating to a learner which we acquire in the course of our work. Confidential information includes personal details. â€Å"Confidentiality can be defined as when one person receives personal or sensitive information from another person, then that person who receives the information has a duty not to pass it on to any other person without the consent of the person who confided in them. We will write a custom essay sample on Summarise Key Aspects of Legislation or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page † As a professional teacher, I won’t share any information regarding my students unless the situation requires it. I’ll do my best to keep safe the information they are sharing with me and to gain their trust, if they will trust me then they’ll feel safe in my classroom. â€Å"The Data Protection Act 1998 (DPA 1998) is an act of the United Kingdom (UK) Parliament defining the ways in which information about living people may be legally used and handled. The main intent is to protect individuals against misuse or abuse of information about them. † Calin Rusu Equality and Diversity Act (2010) is another important legislation which is linked to every LLUK standard. In my opinion, knowing and understanding the Equality and Diversity Act is crucial for me as a teacher in order to assess every learners needs and to meet these needs. It is not easy to treat all my students equally, especially if they are different nationalities, different races, different backgrounds and maybe with disabilities. But, with the initial assessment rrrr,,,, and choosing the right learning strategies and resources I’m sure I’ll be able to meet every learners needs. In order to succeed in meeting all my learners’ needs, I’ll use group tasks; I’ll differentiate them according to their level of knowledge, their learning styles, and by their disability if this is applicable without letting them feel discriminated. Disability Act (2010) refers to those people whom got a medical condition that requires special attention and extra care and helps us, as teachers to treat them equally and not let them feel excluded, this Act can be linked to A, B and F Domains from LLUK standards. If in my course of work I’ll have to deal with a disabled learner I’ll try to plan the session according www,,, to this and prepare for him appropriate tasks. I’ll try to widen my knowledge about his/her disability to know better his/her needs and what teaching strategies do I have to use for him/her to achieve. Another important legislation which can be linked to A, B and F Domains of the LLUK standards is Discrimination Act (2010) which explains how I, as a teacher must treat everybody equally no matter what their sex is, religion, race, age or sex orientation. Health and Safety Act (1974) and Management of Health and Safety Regulations (1999) are two of the most important pieces in Health and Safety legislation being linked to all LLUK standards Domains. These legislations were enacted in order to set the standards that must be met to ensure the health and safety of all employees, learners and all others who may be affected by any work activity. References: Calin Rusu http://www. atl. org. k/health-and-safety/legal-framework/health-safety-legislation. asp (accessed on 22. 05. 2013) http://www. psnc. org. uk/data/files/PharmacyContractandServices/ClinicalGovernance/briefing_on_confidentiality. pdf (accessed on 17. 05. 2013) http://www. kingston. gov. uk â€Å"Learner Confidentiality and Data Protection Policy† (accessed on 17. 05. 2013) http://searchstorage. techtarget. co. uk â€Å"DEFINITION U. K. Data Protection Act 1998 (DPA 1998)† (accessed on 17. 05. 2013)

Summarise Key Aspects of Legislation free essay sample

In order to keep up with the changes, I need to ensure that I meet the highest possible standards. Following this, I must be committed to my own professional learning, seeking to expand my skills and to deepen my knowledge as a teacher. Now I’m going to say a few words about some of the most important legislations that comply with in order to become a good teacher. Calin Rusu Confidentiality and Data protection Act (1998) are very important legislations for a teacher being linked to the Domains A and E from LLUK standards. Learners expect us to respect and protect confidentiality. This duty extends to any information relating to a learner which we acquire in the course of our work. Confidential information includes personal details. â€Å"Confidentiality can be defined as when one person receives personal or sensitive information from another person, then that person who receives the information has a duty not to pass it on to any other person without the consent of the person who confided in them. We will write a custom essay sample on Summarise Key Aspects of Legislation or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page † As a professional teacher, I won’t share any information regarding my students unless the situation requires it. I’ll do my best to keep safe the information they are sharing with me and to gain their trust, if they will trust me then they’ll feel safe in my classroom. â€Å"The Data Protection Act 1998 (DPA 1998) is an act of the United Kingdom (UK) Parliament defining the ways in which information about living people may be legally used and handled. The main intent is to protect individuals against misuse or abuse of information about them. † Calin Rusu Equality and Diversity Act (2010) is another important legislation which is linked to every LLUK standard. In my opinion, knowing and understanding the Equality and Diversity Act is crucial for me as a teacher in order to assess every learners needs and to meet these needs. It is not easy to treat all my students equally, especially if they are different nationalities, different races, different backgrounds and maybe with disabilities. But, with the initial assessment rrrr,,,, and choosing the right learning strategies and resources I’m sure I’ll be able to meet every learners needs. In order to succeed in meeting all my learners’ needs, I’ll use group tasks; I’ll differentiate them according to their level of knowledge, their learning styles, and by their disability if this is applicable without letting them feel discriminated. Disability Act (2010) refers to those people whom got a medical condition that requires special attention and extra care and helps us, as teachers to treat them equally and not let them feel excluded, this Act can be linked to A, B and F Domains from LLUK standards. If in my course of work I’ll have to deal with a disabled learner I’ll try to plan the session according www,,, to this and prepare for him appropriate tasks. I’ll try to widen my knowledge about his/her disability to know better his/her needs and what teaching strategies do I have to use for him/her to achieve. Another important legislation which can be linked to A, B and F Domains of the LLUK standards is Discrimination Act (2010) which explains how I, as a teacher must treat everybody equally no matter what their sex is, religion, race, age or sex orientation. Health and Safety Act (1974) and Management of Health and Safety Regulations (1999) are two of the most important pieces in Health and Safety legislation being linked to all LLUK standards Domains. These legislations were enacted in order to set the standards that must be met to ensure the health and safety of all employees, learners and all others who may be affected by any work activity. References: Calin Rusu http://www. atl. org. k/health-and-safety/legal-framework/health-safety-legislation. asp (accessed on 22. 05. 2013) http://www. psnc. org. uk/data/files/PharmacyContractandServices/ClinicalGovernance/briefing_on_confidentiality. pdf (accessed on 17. 05. 2013) http://www. kingston. gov. uk â€Å"Learner Confidentiality and Data Protection Policy† (accessed on 17. 05. 2013) http://searchstorage. techtarget. co. uk â€Å"DEFINITION U. K. Data Protection Act 1998 (DPA 1998)† (accessed on 17. 05. 2013)

What is Artistic Beauty essays

What is Artistic Beauty essays Dr. Marck L. Beggs, Director M.L.A. Program What is Artistic Beauty? From the beginning of time, men and women have scrutinized, categorized, and compared components of their surroundings in an attempt to better understand their world. In the Bibles Genesis account, Adam, seemingly in appreciation of Eves uniqueness and beauty, poetically proclaims her, bone of my bones and flesh of my flesh; she shall be called woman, for she was taken out of man.[Gen. 2:23 NIV] Much later, artists, writers, and philosophers have sought to understand beauty, balance, and perfection the sublime. Their struggle to define perfection and to set standards of beauty was termed aesthetics or, the science of the beautiful, in 1753 by German philosopher Alexander Gottlieb Baumgarten. Baumgarten was considered the first modern philosopher to approach the question of beauty systematically, introducing the term aesthetics and defining the experience of beauty as the sensory recognition of perfection. [Danto 1]. The works of his contemporary, Immanuel Kant, express the notion that beautiful objects are without a specific purpose and that judgments of beauty are not expressions of mere personal preference but, rather, universal. Similarly, Encarta defines aesthetics as: A branch of philosophy concerned with the essence and perception of beauty and ugliness, dealing with the question of whether such qualities are objectively present in the things they appear to qualify, or whether they exist only in the mind of the individual; hence, whether objects are perceived by a particular mode, the aesthetic mode, or whether instead the objects have, in themselves, special aesthetic qualities. Philosophy also asks if there is a difference between the beautiful and the sublime. [Danto 1] However, even with a definition at hand, arriving at a consensus on precisely what c...

Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words

Gene Analysis - Essay Example Gene therapy, integrating vectors carrying therapeutic transgene sequences offers the potential for a permanent cure of genetic diseases by stable vector insertion into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic animal and that's why it is important to know probability of non specific integration of this transgene and its effect on cellular homeostasis. As per the present understanding the integration is semi-random in nature and having partial preference towards sequences in or near the coding regions of expressed genes (1). Integration in these places may lead to up or down regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of given vectors in model system. Based on bio-informatical analysis of given sequence, we were able to demonstrated that Viral vector integra tes in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. Detailed investigation and database search indicates Nfib has potential role in cell cycle regulation and oncogenesis. Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was BLAST against the Mouse genome database (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http://genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http://rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base. GeneSequence: 5'AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3' Results and discussion: The sequence was used for similarity search by BLAST in mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of given sequence. FIG 1: BLAST results >ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6J Length=28591323 Features in this part of subject sequence: nuclear factor I/B Score = 191 bits (103), Expect = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/Plus Query 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217 Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104 Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr4:81761404-82176981 bp, - strand). Nfib is member of protein family having diverged role in transcription and cell cycle regulation.Similarly BLAT analysis retrieves same gene against the query of given sequence.

Experiment or Quasi-Experiment Coursework Example | Topics and Well Written Essays - 250 words

Experiment or Quasi-Experiment - Coursework Example According to William M.K. Trochim, in this type of research design the most often used group is the intact groups which we think are similar as the treatment and control groups. Two significant characteristics of the NEGD are clearly manifested in this experiment. First, the sample group that is used in the experiment is practically similar in the sense that these kids all have high self-efficacy in playing softball. The second characteristic is the non-random manner of choosing the group. All the components of the group have high self-efficacy in playing softball. This clearly shows that the components of the group are not randomly picked. This experiment is definitely a quasi-experiment due to the fact that the selected group is considered without any random pre-selection process, and upon which a variable is tested. In addition, the result that is achieved of this experiment is used in generating results for general trending. Although this experiment is done for the measurement of social variables, this experiment uses the self-efficacy measurement which can actually be statistically analyzed and

Importance of Professionalising HRM in Hotel Industry Essay - 20

Importance of Professionalising HRM in Hotel Industry - Essay Example From this paper it is clear that each department requires personnel to operate and mange the different types of customers. Thus, there is a need for HRM in a hotel because every aspect in a hotel is concerned with handling people. A HRM professional can understand the needs and preferences of employees and can handle the employee related problems quite efficiently than others. From the provided case, it can be observed that it is a challenge for Happy Hotels to recruit, develop and maintain workforce which is significant for the hotel because a good motivated workforce is the key for providing high quality services to the sensitive customers. The approaches undertaken by Happy Hotels are quite different than the other high cost hotel services. It provides customers with excellent services, comfortable rooms, and good meals with minimal budget than other high cost hotel such as Premium Inn or Holiday Inn. Thus, the job description in Happy Hotels needs range of skills and qualities. The employees must have knowledge to interact with various customers who can impact the HRM strategies such as recruitment and training of employees. HRM can broadly manage the employees in Happy Hotels and can aid the hotels to pursue their path towards achieving success. There are many reasons for professionalising HRM in the expansion of hotel group. Every hotel seeks to dev elop their services which can differentiate them from other competitors. Thus, a hotel will always endeavour to focus on providing customers any product or service which is new and innovative. The employees of the hotels will play one of the major roles in fulfilling this endeavour of the hotels. Thus, the employees need to learn behaviour such as readiness to tolerate uncertainty and changeability. They need to take risks. A highly skilled HR individual can help to achieve high level of autonomy in a hotel.

Holiday Inn Strategic Management

Holiday Inn Strategic Management Management can be generally defined as a art and science of getting the things done from others. The previous definition explains that a manager plans and guides a particular work which is done by other people. In this assignment I will be discussing about different strategic management process. Strategic management process is one of the very important management process which are been used by different organisations. Strategy :- Strategy are the resources used by the managers to achieve long term objectives. In simple term, strategies are the ideas which are been used by the management. Strategic management : Strategic management is a conduct of drafting, implementing and evaluating cross functional decisions in enabling to achieve its long term objectives. There are different types of process involved in strategic management :- Marketing is accepted globally as a life blood of any organisation. In this analysis I felt that strategic management is at the same level as marketing which decides the future and prosperity of an organisation. Practicing the management of strategies is very crucial in the competitive world. Successful managers will have to know their business market situation and position and to implement the strategies when required. I kept these objectives in mind and invented some management qualities in myself while doing a research on this topic. I feel that I need more knowledge of the management practices. So in my research on strategic management I had a good understanding of strategic management and practices. Basically the concept of strategic management closely resembles elements of foresights; this means planning a head is a major element in the business. Strategic management is considered as a life blood of any organisation. This assignment on strategic management covers the change and development in the organisation. I have also understood that having a clear idea of strategic management is crucial in todays competitive business world. Companys now a days seek ways to achieve a competitive advantage with other players in the industry that they operate. The environment in which a company operates can provide circumstances where the outcomes may be positive or negative. Many organisational studies have presented numerous theories that help companies in taking new ways in dealing with their operations. Strategic management is one of those important management theories and process that has been employed constantly by any business to address their management and decision making needs. I have chosen Holiday Inn as an example to illustrate the adaptation of strategic management and its process. In this assignment I have written about how holiday inn hotels analyse and critically evaluate the organisation practice to solve the problem connected with implementing their strategies. Main body :- Now I will be giving a short history on Holiday Inn hotel. Kemmons Wilson initially came up with the idea after a family road trip to Washington, D.C., during which he was disappointed by the quality and consistency provided by the roadside motels of that era. The name Holiday Inn was given to the original hotel by his architect Eddie Bluestein as a joke, in reference to the Bing Crosby movie. In 1957, Wilson franchised the chain as Holiday Inn of America and it grew dramatically, following Wilsons original tenet that the properties should be standardized, clean, predictable, family-friendly and readily accessible to road travellers. By 1958, there were 50 locations across the country, 100 by 1959, 500 by 1964, and the 1000th Holiday Inn opened in San Antonio, Texas, in 1968. The chain dominated the motel market, leveraged its innovative Holidex reservation system, put considerable financial pressure on traditional hotels and set the standard for its competitors, like Ramada Inns, Quality Inn, Howard Johnsons, and Best Western. By June 1972, when Wilson was featured on the cover of Time magazine, there were over 1,400 Holiday Inn hotels worldwide. Innovations like the companys Holidome indoor pools turned many hotels into roadside resorts. The company later branched into other related enterprises, including Medi-Center nursing homes, Continental Trailways, Delta Queen and various related enterprises. Wilson also later developed the Orange Lake Resort and Country Club near Orlando and a chain called Wilson World Hotels. The family of founder Kemmons Wilson still operates hotels as part of the Kemmons Wilson Companies of Memphis. Wilson retired from Holiday Inn in 1979. Although still a healthy company, changing business conditions and demographics saw Holiday Inn lose its market dominance in the 1980s. Holiday Inns, Inc. was renamed Holiday Corporation in 1985 to reflect the growth of the companys brands, including Harrahs Entertainment, Embassy Suites Hotels, Crowne Plaza, Homewood Suites by Hilton and Hampton Inn. In 1988, Holiday Corporation was purchased by UK-based Bass PLC (the owners of the Bass beer brand), followed by the remaining domestic Holiday Inn hotels in 1990, when founder Wilson sold his interest, after which the hotel group was known as Holiday Inn Worldwide. The remainder of Holiday Corporation (including the Embassy Suites Hotels, Homewood Suites by Hilton and Hampton Inn brands) was spun off to shareholders as Promus Companies Incorporated. In 1991, Bass launched Holiday Inn Express, a complementary brand in the limited service segment. In 1994, Bass launched Crowne Plaza, a move into the upscale hotel market. In 1997, Bass cr eated and launched a new hotel brand, Staybridge Suites by Holiday Inn, entering the North American upscale extended stay market. In March 1998, Bass acquired the InterContinental brand, expanding into the luxury hotel market. In 2000, Bass sold its brewing assets (and the rights to the Bass name) and changed its name to Six Continents PLC. InterContinental Hotels Group (IHG) was created in 2003 after Six Continents split into two daughter companies: Mitchells Butlers PLC to handle restaurant assets, and IHG to focus on soft drinks and hotels, including the Holiday Inn brand. Business relationship with Gulf Oil In 1963, Holiday Inn signed a long-term deal with Gulf Oil Corporation in which the lodging chain would accept Gulf credit cards to charge food and lodging at all of its hotels (in the United States and Canada). In return, Gulf would build service stations on the premises of many Holiday Inn properties, particularly those along or near major U.S. and Interstate highways. Many older Holiday Inns locations (including some no longer part of the chain) still have the service station properties intact today, either still in operation or closed down. With the exception of a few locations in the eastern U.S., hardly any of the still-open stations are now Gulf outlets. The portion of the agreement which permitted Gulf credit cards to be used for payment of food and lodging at Holiday Inns was copied by competing lodging chains and major oil companies during the mid-to-late 1960s. Most of those agreements fizzled out with the 1973 oil crisis. The Gulf/Holiday Inn arrangement ended around 1982 . The brand name Holiday Inn is now owned by IHG, which in turn licenses the name to franchisees and third parties who operate hotels under management agreements. In January 2002, The Wall Street Journal reported that the company, led by Ravi Saligram, was producing a new 130-room Next Generation prototype hotel to rebuild the brand. It would include a bistro-like restaurant and an indoor pool. The first of these prototype hotels, the Holiday Inn Gwinnett Center, was built in Duluth, Georgia, in 2003. On 24 October 2007, IHG announced a worldwide relaunch of the Holiday Inn brand. The relaunch is focused on delivering consistently best in class service and physical quality levels, including a redesigned welcome experience and signature bedding and bathroom products The first relaunched Holiday Inn is expected to open in the USA in the spring of 2008. The whole relaunch process is planned to be complete by the end of 2010. In September 2008, IHG announced the creation of a new timeshare brand, Holiday Inn Club Vacations, a strategic alliance with The Family of Orange Lake Resorts. As told before strategic management is a set of activities undertaken in the order of time. One of the first tasks in strategic management is environmental analysis. Environmental analysis is the study of an organisations environment to pin point the environmental factors that can significantly influence the organisational operations. It provides a frame work for understanding an organisations environment with the aim of helping to find the key issues and different ways of coping up with the complexity and change. A business organisation operates in an external and internal environment. The factors which influencing the external environment is known as PESTEL. PESTEL stands for political factors, economical factors, social factors, technological factors, ecological factors and legal factors. Analysis:- The political, economical and social context stood as a big challenge for the organisation of Holiday Inn when they entered the market. the holiday inn operations are highly influenced by the policies set by the government in which ever territory or country they operate. Most of the Holiday Inn are controlled by regulations of operations and policies of individual properties. The Holiday Inn group will also focus on concerns such as health and safety employment, laws , worker protection and environment. From my studies I think all these elements are seen in the control of government that authorises licensing of hotels in different states. Being in a business environment they have to abide by the employment procedures and tax obligations where they operate. As the company is widely expanded and well developed they must co-operate with the practices set by political body. After my research I think this company should get full co-operation from the political power to succeed in local an d international market. as many private enterprise when holiday inn was opened the management had very informal sense of direction setting up a few long time goals without implementing proper strategy. How ever by implementing a new scenario in their strategy with set an international competitive advantage in hotel industry as tourist increased every where and the hotel accommodation was in demand after this the management of Holiday Inn realised the need and development of planning strategies. The management achieved a competitive advantage position and enhanced the holiday inn groups performance in relation to its competitor. Company have taken a very good advantage of this point and served this market segment all the time. They have given market what they want according to the expectations. I think by going through company history the Holiday Inn is spread all over the world. This vast expansion is because of its good economical stability. The company has its own concerns involving economic factors. The branches and franchise like Holiday Inn has the tendencies to experience the hard ships in instances where the economy of the respective countries is hit by inflation and changes in exchange rates. Because of the disposable income of the citizens in developed countries the holiday inn group gave prior importance in marketing their business because of the economic stability of these countries. Holiday Inn is a world wide chain and its international functional strategies will always yield profitable returns. The potential customers are from all over the world. It is been noted that the holiday inn company has given the market such as Europe, Asia, America with regards to their social-cultural needs. Holiday Inn, like all other hotels has established a good system in determining the needs of the market. The company uses the concept of product, personality, behaviour of the customer and purchasing to its advantage. Now I am going to talk about the technical factors influencing the company. This is because of the technical advancement due to which the company could reach in a very short span to many people about their various products and service information. Customers can contact Holiday Inn by many means such as emails, telephone, travel agents, website etc. holiday inn is providing their guests with all modern amenities and facilities to their rooms to provide the best accommodation experience. Their hotels all over are fully equipped with modern amenities and technical advancement. The above mentioned study helped me a lot to determine how much the elements of PESTEL were helpful and positive for the development of the company After the analysis of PESTEL and depending upon that outcome I have also carried out SWOT analysis of the company Holiday Inn which gives me exact position of the company in the market. SWOT stands for strength, weaknesses, opportunities and threats. These are the factors influencing the internal environment. SWOT analysis is extremely useful for understanding and decision making for all source of situation in business and organisation. It also provides a frame work for reviewing strategy position and direction of the company. I think it is therefore important to evaluate the environment opportunities in relation to the strengths and weaknesses of the organisation resources. Strengths: as mentioned in the history of the company it clearly states that the Holiday Inn Corporation is a well established organisation and industry leader in hospitality. Holiday Inn is well diversified hotels in the high end, business and mid priced classes in their product mix. Holiday Inn also poses a solid integration features such as owning the companies that manufacture its furniture and has invested in online reservation travel enterprises. It also has easy access to all its customers to get information and also has a excellent reservation system. Weaknesses: according to my research Holiday Inn may be narrowly focused making it susceptible to the down turn in the global economy and other world wide catastrophes that could limit global travel. Holiday inn hotels may also be venerable to employees strikes and crack down on undocumented workers. I think the aggressive expansion policies may put the company in trouble during the global down turn. Some of the branches or franchises do not follow the holiday inn set standards, recruitment process efficient accounting systems. Opportunities:- Holiday Inn corporation is a global pioneer in hospitality industry. Their position is strong financially and they are widely expanding all over the world. They offer an array of distinctive and specialised services to their guests. They also have an opportunity to expand or acquire a cruise line company. The holiday inn corporation should take advantage of emerging markets especially with business clients and mid priced markets. The holiday inn corporation has a strong affiliation with REIT (real estate investment trust) or similar organisation that provides a strong back up for hotels. It has a strong skilled work force all over. Threats: Like all other business, the major threat for holiday inn will be an emergence of a new competitor. The competitors will be more active in promoting the concept of global brand name. Holiday Inn has its own resources to sustain their global brand name. In general the hotel industry faces a threat from internet reservation channels which represents a growing share of hotel room booking. To overcome these threats Holiday Inn has its own centralised reservations system. Looking at strategic direction of the company the mission statement says GREAT HOTELS GUEST LOVE shows that holiday inn makes all efforts to exceed their customer expectation. This statement covers all aspects on hospitality firm in a brief manner. The vision statement and the values of the company states that year after year holiday inn (IHG) and the management will be regarded as the best and most sought hospitality group. From my personal experience while working with holiday inn group I can say that they are following their vision and mission statements. By observing their strategic formulation they have adopted cost leadership strategies. They are one of the lowest cost providers for their product. This makes many customers to become potential and loyal. They have targeted very broad market from high and society to middle and the lower one. While offering this wide variety of offers to the customers they have developed and achieved best value strategy. During my analysis on holiday inn I discovered the difficulties faced by them or in other words we can say their weakness. They faced great difficulties while entering the Asian markets. The reason behind this was they were not familiar with Asian market. To overcome this problem they had to take a strong action plan by signing a joint partnership with Asian hotel firms. This provided them a base to learn about the Asian environment and their establishment. Holiday Inns vision for the future was a property that delivers new levels of customer convenience by extending hotel systems for guest and employee access using the hotels wireless infrastructure. RECOMMENDATIONS :- From my analysis since holiday inn is expanding it is wise to deal with proper authorities in the respective markets where they intend to operate. The company has to accomplish and satisfy all the prerequisites for doing business. The company should also carry out a well conducted market research before penetrating the new segments of market. the company should always obtain relevant information from the target market in addition to the individual customers of organisation. A comprehensive market research is a must before granting a franchise. I think similar research should be made in areas like consumer behaviour and purchasing patterns of the market. Holiday Inn Corporation has to re-evaluate its internal environmental factors like Strengths, Weakness, Opportunities and threats to overcome with a strategic direction adjusting its mission and vision and at the same time maintaining its values. These are the few strategies that holiday inn must adopt to attract more diversified clie ntele. Therefore in order to survive and maintain the brand name holiday inn corporation should be consistent with their excellent service being always innovative. They should also create the role of middle managers and let them to be more innovative. I think the biggest challenge for Holiday Inn is expansion and franchises. The main features of Holiday Inn Corporation should be put as a standard one for the franchisers to follow. Will the franchisers really set the standards followed by Holiday Inn Corporation? What are the efforts that are to be put for the franchisers to follow the standards set by Holiday Inn Corporation? Holiday Inn is also using its technology to its advantage. The interactivity and the real time effects of communication is a good way to find suppliers. CONCLUSION :- Successful strategies always demand a company to choose the market in which their unique capabilities will gain competitive advantage. However the adoptive and incremental context of strategic management means that the company starting point leads the firm to a stable position. Corporate strategies of Holiday Inn have been able to use strategic management to stay in the competition in the global market. I believe that the strategies as well as the leadership styles used by the management of Holiday inn have been the major cause of their competitive position in the hotel market. Though Holiday Inn is considered as a leader in hospitality sector there is a need of flexibility. Slight changes in the market can effect their operations of the business. They should not rely on their past success but instead they should innovative and ready for any future uncertainties. Holiday Inn Corporation focuses on services rather than accommodation itself. I truly agree that the true asset of the organisation is the staff. The staff are the one who represent Holiday Inn hotels through their excellent services. So there is a need to make sure that the staff is always happy with the behavioural integrity of work place. The corporate strategy of Holiday Inn has been able to guide the company from challengers and opportunities that appears in the market environment in order to sustain the competitive advantage. Therefore I think the leaders of the company should continue their style to motivate their employees and become a major asset for the success of the company.

All Quite On The Western Front Essay -- essays research papers

â€Å"All Quiet On The Western Front†   Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  World War I was a fierce and very disturbing time for many people. During war people will stretch their own personal boundaries and limits just to stay alive. Although every solider was someone’s son, by the end of the war this was not a factor. By thinking of an enemy as less then human, the act of killing someone’s son was a little easier on the minds of each soldier. To everyday people it is apparent that the war changes people, but the extent of the change is not so easy to see. This change is symbolized in the movie, â€Å"All Quiet On The Western Front.†   Ã‚  Ã‚  Ã‚  Ã‚  At the beginning of the movie, Paul Baumer and his friends were excited about the war. Their teacher Mr. Kantorek, had put a theory in their heads that war was a patriotic duty. If you loved and wanted to support your country, then going to war was a must. With this theory in your head, the act of war is a very difficult thing to handle. Paul realized that war was a horrible place to be. Yes you were fighting for your country, but at the same time all of your friends and family were dying around you. In the end was it really worth it? This was the question that ended up on Paul’s mind, and was a question that would not be soon to leave his conscience.   Ã‚  Ã‚  Ã‚  Ã‚  Paul was a good boy. He had a good education, was a non-smoker, and had many friends. His teacher was amazed a...

Education in Pakistan Essay

President Asif Ali Zardari signed ‘The Right to Free and Compulsory Education Bill 2012’ into law. The bill, which sought to ensure all children between five to 1 6 years of age are provided free education. He urged provincial governments to promulgate similar legislations in their respective assemblies as well. He said the responsibility for providing free education rests with both federal and provincial governments, referring to article 25-A of the Constitution. The article 25-A of Constitution of Pakistan obligates the state to provide free and compulsory quality education to children of the age group 5 to 16 years. The federal government will now provide free textbooks and uniform s to children and ensure schools have qualified teachers. Free pre-school education, early childhood care and free medical and dental inspection will also be provided to all citizens and no child will be subjected to corporal punishment â€Å"Under the law, private schools will be required to provide free education to disadvantaged students, who will comprise 10% of each class,† Zardari said, adding that school management committees will be established to persuade parents into sending their children to schools. â€Å"We will honor our international commitments and achieve the targets set by the Education for All and Millennium Development Goals initiatives. National Educational Policy 2009 Under the 18th constitutional amendment control and management of the education sector has been devolved to the provinces. They are now responsible for the key areas of the education sector i.e. curriculum and syllabus, centers of excellence, standards of education up to intermediate level (Grade 12) and Islamic education. Planning and policy and standards of education beyond Grade 12 are covered under Federal Legislative List. All the provinces have shown their commitment to the National Education Policy 2009. The National Educational Policy (NEP) 2009 is a milestone which aims to address a number of issues including: * Quality and quantity in schools and college education * Universal primary education * Improved Early Children Education (ECE) * Improved facilities in primary schools * Converting primary schools to elementary schools * Detaching classes XI-XII from college education * Adopting a comprehensive definition of ‘free ‘education * Achieving regional and gender parity especially at elementary level the share of resources for education in both public and private sectors Accordingto the latest Pakistan Social and Living StandardsMeasurement (PSLM) Survey 2010-11, the literacyrate for the population (10 years and above) is 58percent during 2010-11,

computer literacy

computer literacy The Impact of Mobile Computing Running head: the impact of mobile computing 1the impact of mobile computing 9The Impact of Mobile ComputingDorothy AshfordINFO 103 Computer LiteracyInstructor Sabahudin TricicAugust 14, 2014The advancement of technology has made it possible to have access a computer and the internet, anywhere. Internet access was once limited to home, office, or school. That is a thing of the past. We can access a computer and the internet through mobile computing. Most of our everyday lives depend on some type of mobile device. This article explores the impact of mobile computing. How much has mobile computing affected our daily lives as students, professionals, and kids?According to the author Bowles, there are hundreds of thousands of apps that programmers designed especially for mobile devices. For example, location-based services, provide the user information based on their location, social networking, sharing information with friends (like Facebook, Twitter, and Instagram), mobile search, help people search for information based on their location, such as asking a smartphone to tell the user where the nearest pizza shop is and mobile commerce lets users check into a store they are physically at to gain special information about products.The study of photography is one field in which it's easy to find out the impact computers have on our daily lives. Thanks to digital cameras, anyone can shoot, develop, and publish photographs. No particular skills or equipment are required. This is good for people who want to share pictures on Facebook or Instagram. For people who use photos for business purposes, digital photography can present ethical issues. There are two areas of concern: adherence to copyright laws and ethical concerns regarding alteration of photographic images. "Copyright laws give people who create content-such as books, movies, music, or photographs-ownership rights to that content.Created by the previous uploader using a popular O...As I have pointed out elsewh ere (Besser 1988), polls of computer use indicated that the people buying them weren't quite sure what kind of new or interesting use they would put these to. Just as people continued to buy computers for reasons other than a clearly demonstrated utilitarian function, forces continued to press for computer education in the schools without any kind of clear demonstration of how this would make students into better functioning members of our society.The pressure for "computer literacy" did not come from some clear and pressing need for "good citizens" to have to know about these machines. Rather, this movement came from the traditional forces which had shaped public education since its very beginnings. In this chapter we will see how the corporate need for a trained workforce and the competitive need to keep America ahead of other countries economically and...

History of Ice Cream

History of Ice Cream The origins of ice cream can be traced back to at least the 4th century BCE. Early references include the Roman emperor Nero (37-68 CE) who ordered ice to be brought from the mountains and combined with fruit toppings, and King Tang (618-97 CE) of Shang, China who had a method of creating ice and milk concoctions. Ice cream was likely brought from China back to Europe. Over time, recipes for ices, sherbets, and milk ices evolved and served in the fashionable Italian and French royal courts. After the dessert was imported to the United States, it was served by several famous Americans. George Washington and Thomas Jefferson served it to their guests. In 1700, Governor Bladen of Maryland was recorded as having served it to his guests. In 1774, a London caterer named Philip Lenzi announced in a New York newspaper that he would be offering for sale various confections, including ice cream. Dolly Madison served it in 1812. First Ice Cream Parlor in America - Origins of Name The first ice cream parlor in America opened in New York City in 1776. American colonists were the first to use the term ice cream. The name came from the phrase iced cream that was similar to iced tea. The name was later abbreviated to ice cream the name we know today. Methods and Technology Whoever invented the method of using ice mixed with salt to lower and control the temperature of ice cream ingredients during its making provided a major breakthrough in ice cream technology. Also important was the invention of the wooden bucket freezer with rotary paddles, which improved the manufacture of ice cream. Augustus Jackson, a confectioner from Philadelphia, created new recipes for making ice cream in 1832. Nancy Johnson and William Young - Hand-Cranked Freezers In 1846, Nancy Johnson patented a hand-cranked freezer that established the basic method of making ice cream still used today. William Young patented the similar Johnson Patent Ice-Cream Freezer in 1848. Jacob Fussell - Commercial Production In 1851, Jacob Fussell in Baltimore established the first large-scale commercial ice cream plant. Alfred Cralle patented an ice cream mold and scooper used to serve on February 2 1897. Mechanical Refrigeration The treat became both distributable and profitable with the introduction of mechanical refrigeration. The ice cream shop or soda fountain has since become an icon of American culture. Continuous Process Freezer Around 1926, the first commercially successful continuous process freezer for ice cream was invented by Clarence Vogt. The Ice Cream Sundae Historians argue over the originator of the ice cream sundae but three historical probabilities are the most popular Ice Cream Cones The walk-away edible cone made its American debut at the 1904 St. Louis Worlds Fair. Soft Ice Cream British chemists discovered a method of doubling the amount of air in ice cream creating soft ice cream. Eskimo Pie The idea for the Eskimo Pie bar was created by Chris Nelson, an ice cream shop owner from Onawa, Iowa. He thought up the idea in the spring of 1920 after he saw a young customer called Douglas Ressenden having difficulty choosing between ordering an ice cream sandwich and a chocolate bar. Nelson created the solution, a chocolate covered ice cream bar. The first Eskimo Pie chocolate covered ice cream bar on a stick was created in 1934.​ Originally Eskimo Pie was called the I-Scream-Bar. Between 1988 and 1991, Eskimo Pie introduced an aspartame-sweetened, chocolate-covered, frozen dairy dessert bar called the Eskimo Pie No Sugar Added Reduced Fat Ice Cream Bar. Haagen-Dazs Reuben Mattus invented Haagen-Dazs in 1960, He chose the name because it sounded Danish. DoveBar The DoveBar was invented by Leo Stefanos. Good Humor Ice Cream Bar In 1920, Harry Burt invented the Good Humor Ice Cream Bar and patented it in 1923. Burt sold his Good Humor bars from a fleet of white trucks equipped with bells and uniformed drivers.

Given that users prefer redress mechanisms to be independent, what Essay

Given that users prefer redress mechanisms to be independent, what justifications explain why some parts of redress mechanism are independent and others are not - Essay Example A good example is the tribunals that are managed by independent tribunals that automatically have to be independent. This is for the reason that they function in a quasi-judicial approach that needs no influence from other forces. These tribunals would, therefore, make it easier for implementation of policies of the tribunals. The Ombudsmen services are yet other independent bodies2. They are run under the leadership of independent Ombudsmen, mostly referred to as commissioners. These bodies need to be independent for the reason that they are charged with the responsibility of investigating various complaints from the citizens. In the case of poor administration, or even offering of poor services to the citizens, these organizations ought to operate independently, if the results have to be free and fair. The Parliamentary and Health Services Ombudsman Offices are the most common in

Consider the functions of directors,company secretaries, auditors and Essay - 1

Consider the functions of directors,company secretaries, auditors and shareholders. In what ways do they contribute to the operation of both private and public limited companies - Essay Example Therefore the given essay analyses the role of all these four groups of actors (directors, company secretaries, auditors and shareholders) in order to demonstrate the importance of each of them in operation of both private and public companies. Firstly, directors are the key actors for the company’s performance on market. In general, they are important because they create the policy of the company (Osemeke, 2014). In the circumstances of either private or public limited company, this role changes only slightly. In fact, private company may have sole director, while public limited company needs two or more directors (Rosenfalck, 2013). In addition, Directors Board becomes the only significant representative, if there is no existing controlling stakeholder in the company (Davies, 2010). Frequently, this situation appears in private companies (Rosenfalck, 2013). Furthermore, the directors of the company are trained to act their instructions or directions. For example, when there is a serious loss in capital of public company, directors have to gather an extraordinary general meeting not later than 56 days from the day of half or less capital reduction (Rosenfalck, 2013). According to Osemeke, (2014), failures and bankr uptcies of the company are mostly to result an ineffective directors board. In this context, ineffective work of the board has been shown in a recent failures of big companies like Enron and HIH (Convill and Bagaric, 2004). Moreover, Davies (2010) said that directors should care and promote the company’s success and do independent actions. In fact, directors of public companies must be sure that they hire competent company secretary (Rosenfalck, 2013). Among the main flaws of directors that have a direct effect on the company’s performance, according to Osemeke (2014) â€Å"lack of training and induction

Lab Report - Precision and Accuracy Example | Topics and Well Written Essays - 1000 words

- Precision and Accuracy - Lab Report Example The determiner of accuracy is the percentage error, which is valued at 0.06%. Some of these include the lack of experience and poor technique, which actually both go together for when there is lack of experience, the immediate result would be poor technique. Poor technique may be attributed to the parallax error, or the failure to put the eye at a level which is aligned properly to the volume mark of the pipette. This means that if one is looking up the pipette, one can see a meniscus placed too high when it appears to align with the volume mark. In the same way, if one is looking down at the pipette, the meniscus will then be too low when it appears to align with the volume mark. In fact, aside from errors in the placement of the eye with reference to the volume mark, lack of experience and poor technique also translate as the failure of properly aligning the meniscus with the volume mark. ... his means that it would be very hard to control the force by which the solution should be ejected out of the pipette, thus the delivered solution may be slightly more than what is expected. Although there is a standard amount of force when it comes to delivering the solution out of the pipette, the deviation from the standard is brought about by individual differences as no two or three people can exactly deliver the solution out of the pipette using the same amount of force. Besides, this force is too little and is very hard to quantify and estimate physically. Another possible source of error or deviation from the absolute value of the solution is the possibility that the pipette is dirty or the solution is contaminated, thus there is a possibility that tiny droplets of the solution are left on the walls of the pipette resulting in the delivery of too little solution (â€Å"Sources of Error in Pipetting†). Moreover, dirt in the pipette, no matter how little, may cause a slig ht obstruction in the flow of the outgoing solution thus there is also a possibility that the pipette amount of solution is less than what is expected. Another possible source of error or deviation from the absolute or expected value is the possibility of a broken or chipped pipette, no matter how small the break is (â€Å"Sources of Error in Pipetting†). Such a break may cause a disruption in the natural flow of the liquid out of the pipette, thus the outgoing solution is also less than the expected amount. Part B: Conclusion The volume delivered by the pipette was calculated to be 9.99+/- 0.02 mL. The slight change of +/- 0.02 mL is due to a number of factors such as differences in time elapsed during transfer of liquid, possible change in temperature, possible change in evaporation rate, lack of

Personal Reflection Essay Example for Free

Personal Reflection Essay This reflection will discuss personal diffidence and how it has influenced my academic studies, including my practice within placement settings. Gibbs reflective cycle (Gibbs, 1998) has been utilised as it illustrates a clear structure for the process of reflection. To conclude this reflection will draw together the themes which have emerged and highlight a clear action for future learning that will be used in order to enhance my future practice. Within my previous occupation as a health care assistant I was subject to workplace bulling which was allowed to continue for an extensive period of time due to ineffective management of the situation. Vartia (2001, p. 68) suggests that one of the consequences for the targets of workplace bulling is a feeling of low self confidence. This is indeed true of myself; although this occurred prior to commencement of university, I perceive that I am diffident stemming from this experience. This diffidence has influenced my academic studies and my practice upon placement. Feelings: I feel that I find it challenging to settle down within new groups of people. Whilst on placement I feel it takes a significant amount of time to work within my fullest capacity within the team. Spouse (2008, p. 21) state that entering a new placement area can be a daunting experience; suggesting this may be because you are joining a team of strangers who already know each other. However I feel that my previous experience has heightened my apprehension and indeed Bach and Grant (2009) suggest past experience contributes to our attitudes and values and affects what we notice about other peoples behaviour and how we interpret it. Therefore I may unintentionally be vigilant for behaviour that represents past experience. I feel I become emotive when conflict arises both upon placement and within the university environment; therefore I have a tendency to avoid sources of conflict. Furthermore; although I am aware of the need to challenge poor practice witnessed and have done so within the past; it is something that I find particularly challenging and uncomfortable to deal with. I find it uncomfortable to challenge people because I perceive this as a negative source of conflict. I am somewhat afraid of the reactions this may evoke and the impact this could have on my working relationships within the team I am placed. Within my academic studies in the university learning environment specifically; this diffidence has manifested as an apprehension of speaking within groups. This is especially apparent when it is required to perform group presentations. Although my one to one communication and communication within familiar groups is of good quality, communication within unfamiliar groups can be hindered by this diffidence. I am concerned that if allowed to continue; diffidence could be detrimental to my future practice as a nurse. Hagbaghery et (2004) qualitative research findings suggest that nurses perceive competence and self confidence as the most important personal factors influencing nurses clinical decision making, therefore in order to enhance my future practice I feel that it is imperative that I overcome this. Evaluation: Upon evaluation of these feelings I perceive I have progressed and gained confidence thus far, however there is still margin for improvement. I feel that upon a recent eight week placement period whereby I moved across four placement settings; I had an abundance of practice within adapting and participating within new teams. Although I felt that transition across four settings somewhat hindered myself working to my fullest capacity; the positive aspect of this was that it facilitated gain in self confidence. Nash, Lemcke and Sacre (2008) suggest that initially when encountering a new workplace culture trying to be accepted within this new culture can be uncomforting and lead to feelings of inadequacy; however by the end of this eight week period I feel I gained a significant amount of self confidence and I felt confident with my ability to integrate into new teams effectively. Communication is the interaction with people and is at the core of nursing according to McCabe and Timmins (2006, p. 4), therefore I acknowledge that in order to work to my fullest capacity within the nursing profession it is imperative I overcome this apprehension of speaking within groups and performing presentations. I have reflected upon previous experiences within university; contrasting performing our first group presentation to a recent group presentation experience. I perceive a vast improvement however again there is still margin for improvement and gain in confidence. Brankenbridge and Blows (2008, p. 216) have highlighted that there are different ways in which you can challenge, constructive and destructive. Constructive challenges highlight alternatives and leave the person with something of which they can reflect upon, build upon and change. Destructive challenges are delivered in an unskilful fashion leaving the person who has been challenged feeling put down and bad and potentially could be a source of conflict and negative feeling. This is why in the past I have perceived challenging people in practice as a negative action, possibly due to lacking differentiation between destructive and constructive criticism. Analysis: Although I perceive myself as diffident upon analysis I am unaware of how others may perceive my self. According to Barber, McLaughlin and Wood (2009, p. 76) The Johari Window; Luft and Ingham (1955) can show us aspects of ourselves that we believe is how others perceive us, however they further suggest that these aspects may only be a small part of our ‘personality’ as a whole and not necessarily how others perceive ourselves. Which means although I perceive myself as diffident; others may not necessarily perceive my self in this manner and it is essentially necessary that I develop further self awareness. Barber, McLaughlin and Wood (2009, p. 76) perceive development of self awareness as crucial in highlighting how we view and respond to others and in turn how they view and respond to us. The National Health Service (NHS) Modernisation Agency Leadership Centre (2005) have corroborated this view by suggesting self awareness can assist with understanding ones own emotions and the impact of one’s behaviour on others. Therefore one of the many benefits of self awareness for myself may be understanding my colleagues, learning to relax, identifying my strengths and weaknesses and indentifying my own learning needs, Burnard (1997). I perceive assertiveness of which Siviter (2008, p. 116) defines as respecting the rights and feelings of others whilst standing up for yourself and your own rights as a necessary skill which will further facilitate a gain in self confidence. In order to be assertive it is necessary to possess the ability to express your feelings in a direct, open, honest and appropriate manner. Breckenbridge and Blows (2008, p. 217) further suggest that assertive communication is the key to successful relationships for patients, family, nurses and colleagues alike; therefore further development of my assertive communication skills will enhance my future practice and communication with staff, family and patients alike. Development of assertive communication skills may aid when and if the need arises in future practice to challenge colleague’s actions or the actions of people in general. Indeed Breckenridge and Blows (2008, p. 17) suggest assertiveness is a key feature within effective challenging and therefore is an essential skill of which is required to be developed. Assertiveness aids conveyance of important messages and helps individuals stand up for the rights of themselves and others; one example of such being advocacy. Advocacy is reflected within The code in full (Nursing and Midwifery Council, 2008) who state that nurses must act as an advocate for those within their care. Therefore learning to be assertive is not a choice, it is a must if I am to live up to what is expected of me within my role as a student and future nurse. Conclusion and Action Plan: The challenge for the future is that I totally overcome this diffidence. I envisage being able to achieve by developing self awareness. I could develop self awareness by using a tool such as The Johari Window. Academically the challenge is to overcome apprehension regarding communication with unfamiliar groups of colleagues. I anticipate achieving this by taking more time to consider what I am going to before I begin and being prepared for situations where I am required to speak. With regard to performing presentations I will be prepared and rehearse what I am going to say in advance.

Portrayal Of Women In Hip Hop Songs English Literature Essay

Portrayal Of Women In Hip Hop Songs English Literature Essay Disrespecting and Violent Attitude toward Women. It has been around three decades since hip hop emerged on the American cultural scene. The music genres which are associated with hip hop cultural phenomenon, especially gangsta rap and R B are believed to define street youth culture. These two hip hop music subgenres seem to be more influential than the other as there is more emphasis put on lyrical content than the music itself. The abundance of explicit words and messages in the songs makes them also controversial. Before listening to gangsta rap songs, one must be prepared most of all to hear extremely explicit language. The great number of derogatory terms embedded in the song lyrics is especially disturbing as they are greatly addressed to women women of colour in particular. Most of the cases involve name calling and violent attitude directed more likely at women in general than a particular person. Women in those songs are mostly placed in a sexual context and called e.g., bi tch, whore, hoochie, slut. Promoting violent sex theme was well documented in the Kubrin and Weizers research on the sample of 403 Amercian hip hop songs produced throughout the 1992-2000 but also noted in other articles/books etc. on the songs from the period 1987 1993.  [1]  The scholars have found that the main purpose of such songs is to justify violence against women and make it a legitimate tool of social control.  [2]  In such a view hip hop music promotes a set of gendered norms and enforces sanctions for those who do not abide those set up rules. Eminems song Kill You,  [3]  for example, describes women as vile, venomous, volatile bitches. Many other popular rappers, like Redman, Outcast, degrade women to being a chickenhead coined by association with giving oral sex. Whilst such terms are commonly perceived as pejorative, there are instances they may sound somewhat positive. One of the most successful rappers, Ludacris, in his hit song Pimpin All Over the Wor ld raps: I used to think that it was way too cold, til I went to Canada and saw some beautiful hoesà ¢Ã¢â€š ¬Ã‚ ¦Ã‚  [4]  And according to Ja Rule every thug needs a down ass bitch  [5]  , i.e. a girl who is tough, and demonstrates her solidarity with her man and the gang they belong to. While these terms may not carry derogatory connotations in these songs, women are still positioned here within the sexual perspective. Interesting to notice is a fact that offensive terms aimed towards men are usually words with feminine connotation (bitch, pussy): Im slick and slippery/ On a high-speed chase all the way to the victory. / Yall niggaz is stone cold mysteries. / Too weak, cant stand in the ring with me. / Put a pussy back in his place, straightlaced.  [6]  It also seems like to humiliate women goes hand in hand with getting respect from the other men. Men are referred to be pimps who can get a lot of hoes. (à ¢Ã¢â€š ¬Ã‚ ¦) Legalize pimpin for all the pleyas, puttin fine a ss bitches in the streets and the hood.  [7]  While in most of the songs degrading women motif would appear randomly throughout the song, there are also cases in which that would be the main theme. The best example is Too $horts Aint Nothing Like Pimpin: Aint nothing like a mother fucking bitch! / You nasty, once a month bleeding, mother fucking, nasty ass, mother fucking bitch! / I hate your mother fucking ass. To justify their attitude towards women, many rappers give many reasons for doing so, such as women being too shallow: We couldnt get no play from the ladies. / With seven niggas in a Nav [Navigator] is you crazy?/ So we all said fuck you bitch and kept rolling.  [8]   Sometimes verbal disrespecting turns into violent threatening. According to Kubrin and Weizer aggression towards women appeared in almost 18 percent of the hip hop songs analyzed by them.  [9]  Extreme hostility towards women represent the songs of Eminems where he attacks his relatives, especially his mother and ex wife in Under the Influence : all bitches is hoes, even my stinkin ass mom.  [10]  He even threatens to kill them: Bitch Ima kill you! / You dont wanna fuck with me. / Girls leave you aint nuttin but a slut to me. He also seems to be perfectly aware of the fact his lyrics cause controversy. In the same song he admits to that: Oh, now hes raping his own mother/abusing a whore, snorting coke/ and we gave him the Rolling Stone cover? (Eminem, Kill you)  [11]   Violence covers a broad spectrum in hip hop. Not only is it perceived as a legitimate tool of manipulation between men but also serves as an answer for disobedience of women. Such insubordination is interpreted in many ways. According to the rapper Dr. Dre: snobby-ass bitches get slapped out of spite.  [12]  Another popular performer Mase warns his potential sex victims to get tested on sexually transmitted diseases beforehand or else: If she make my nuts itch, I kill that slut bitch.  [13]  Eminem seems to have issues with women in general and promotes violence as the only communication means between men and women. Usurping and assuming power on women in hip hop songs are often represented by descriptions of rough sex: Hit you with the dick, make your kidneys shift/ Im guaranteed to fuck her till her nose bleed.  [14]  Kubrin and Weizer noted four recurring instances of violence in the American gangsta rap songs. Rappers pride themselves on sex acts that are harmful to women. They justify other acts of violence and threaten women who try to defy male supremacy. They also seem to encourage other men to resort to violence acts whenever they find it suitable. Violence seems to be the most appropriate response to women who abuse such gendered protocol, i.e. dont know their place. Women as Sexual Objects The notion of sexual objectification means that a person is perceived through the prism of physical attractiveness with disregard to the persons intellectual abilities.  [15]  Kubrin and Weizer, in their paper on the misogyny in rap music stated that sexual objectification of women was noted in 67 percent of the songs analyzed.  [16]  The main conclusion drawn from these lyrics is that women are only good to satisfy mens sexual pleasures. The title of one of the N.W.A songs, Findum, Fuckum, and Flee. may serve as creed of the street code, according to which mens goal would be pursuit of pleasure and sexual exploitation of women.  [17]  Puff Daddys intentions are brazenly blatant in: Call me Sean if you suck, call me gone when I nut. / Thats the end of us, get your friend to fuck  [18]  . While his fellow rapper, Too $hort, honestly admits the only thing he would try to get from women is sex without strings attached: I aint Romeo, Prince Charming, or a knight in shinin g armor./ Im only out to fuck a bitch, fuck tryin to charm her. I treat a fine ass bitch like dirt./ No money in her purse, a fuck is all its worth./ Cause Short Dawgll never cater to you hoes./ And if you aint fuckin, I say later to you hoes.  [19]   A pretty disturbing fact surfaced in this Xzibits song. Judging by the lyrics, women are considered to be mens property: You got titties and ass./ But I got a dick and some cash./You aint talkin bout shit./ Then Ima smash, bitch./ On three, on me, bitch, you my property.  [20]  This brings back to life one of the atrocities of slavery, when black women were often forced to keep exploitive sexual relations with their slave masters in exchange for better treatment, food, or simply to satisfy the oppressors urge.  [21]  It seems that even though the American society has come a long way from the times of slavery, black women are nowhere near to being treated as free, independent individuals. As the American culture critic bell hooks points in her book Aint I a Woman: Black Women and Feminism, that black women in America have been oppressed from the seventeenth century till today by white men, black men as well as white women. She argues that women of colour have been omitted by the white feminist movement as well as the civil rights movement. The author perceives feminist movement as being a white middle and upper class struggle which showed no interest in issues of women of colour. Black women found themselves trapped into confines both gender and race. Thus, they have never been liberated from the institutionalized sexism patriarchy, and racism. Additionally, in bell hooks opinion the Black Power movement was both patriarchal, misogynistic. As much as it aimed to overcome racial divisions it also sought to reinforce the sexist ones.  [22]  Black male attitude towards their female counterparts presented in number of hip hop songs manifests their pursuit to keep women subordinate. Nowadays many rappers often express how they would put women in the right spot, as Too $hort: Hoes be nothin but slaves for me, / ready to go to their graves for me. (Too $hort, Pimp Me)  [23]  , or Xzibit: (à ¢Ã¢â€š ¬Ã‚ ¦) Im hard on my hoes thats how it goes./ Bitch, get up off your toes, and get my six-four [Chevrolet] (Xibit, Pussy Pop).  [24]   Daniel Patrick Moynihan, an American politician and sociologist, in his report The Negro Family: The Case for National Action, also known as Moynihan Report, released in 1965 analyzed the data from the U.S. department of labor and drew a conclusion that black women had significant advantages over the black men to be employed thus they could provide for the family more effectively. He also suggested that the traditional African American household is ruled by the matriarchal and emasculating women, an archetypical Mammy, which would imply that black men were symbolically castrated by their female counterparts. In order to stop degradation of the Negro family, black men need to seek the ways to restore their manhood.  [25]  The lyrics of contemporary hip hop songs suggest that by degrading women, rappers may seek to regain their manhood. They suggest that the only desirable image of a black woman is the promiscuous and oversexed one as in Redmans: I turn an independent woman back in to a hoochie.  [26]  Notorious B.I.G. humiliates educated girls: I like em educated, so I can bust off on their glasses.  [27]  These stereotypical images have their roots in the times of slavery in America. Southern white males would consider black men and especially women as possessed by their hypersexuality. The reason for such supposition might be cultural differences between Western Europe and Africa of the time. European travelers who visited Africa were often stunned to see semi nude native black women and commonly accepted polygamy. Nakedness in that time was perceived as a manifestation of indecency. The travelers embraced such a shocking experience by assuming that all black women are promiscuous by nature. They contrast between the clothed Victorian ladies and naked native African women may have prompted assumptions that white women, on the contrary to black women, are civilized and sexually pure. Hence the symbol of black women reinforced by such depiction was Je zebel.  [28]  It seems that African American women could not escape from the image of an instinctively promiscuous Jezebel assigned to them back in the slavery era. Stereotypes that were set at that time still affect black women nowadays. What is more, the stereotype of a seductive and lewd black woman has been perpetuated by their male counterparts. As the Jezebel image applied to black slave women might have been a way to justify maltreatment they were given, such reasoning applies also today.  [29]  Another justification for disrespecting women may be a fierce peer pressure on young men in ghettos. Male promiscuity is highly valued there.  [30]  Casual sex with no commitment gets a man proud patch of a player, proves of his masculinity and helps to get respect from the others: I had niggas making bets like, did he fuck her yet?/ Ask her did he touch her bra, when I say nah they say ahh / So tomorrow I use that pressure to undress her.  [31]  The Kubrins research s hows that bragging about sexual achievements was present in 58 percent of the songs.  [32]  Most of it implied how easy for a player is to talk a girl into having sex: You see I order one bottle, then I fuck with one model/ Then I order more bottles, now I/ got more models/ Im from that city where them niggaz dont play mayn/ I take a chick to my/ room like caveman/ So ask your girlfriend my name (à ¢Ã¢â€š ¬Ã‚ ¦).  [33]   Women are also treated as a symbol of achievement. Having a lot of casual sex proves that you are either a player or have a lot of money. As these seem to be the only means of getting a girl into sexual intercourse in the ghetto: Say dog, what kinda nigga be on top of the world?/Million dollar status got me on top of ya girl.  [34]  Ability to sexually please a girl is perceived as a symbol of your high status. Below there is an example of how the rappers fondle their ego in that matter: While your bitch be crying please dont stop. . . I fuck her like I know you wont./ If thats your bitch, homeboy youd better keep her Cause she wont stay off my beeper.  [35]  The female is used here just to partake in a sexual competition between men. Women cannot be granted any respect from the rappers, as they are described to be as much interested in heavy drinking, sex, and money as men. The only difference here is that a man will be positively referred to as a player or a pimp but a girl will be always called a bitch. Lyrics imply that if a girl is being promiscuous and greedy it also justifies the maltreatment she receives from men as in hit song The Gangsta, the Killa, and the Dope Dealer: All on the grass [marijuana], every bitch passed [out]/ A first not last, when we all hit the ass.  [36]  Women are treated as a commodity which can be consumed, used, passed to someone else and given out: I know the pussys mines, Ima fuck a couple more times/ And then Im through with it, theres nothing else to do with it./ Pass it to the homie, now you hit it/ Cause she aint nuthin but a bitch to me.  [37]   Prostitutes are the classic example of sexual objectification and exploitation. Such image of a woman is to be expected in hip hop music since it has emerged out of ghetto setting. This theme has been found present in one-fifth of the songs analyzed by Kubrin and Weizer.  [38]  Prostitution and pimping are celebrated by rappers and classified as a justifiable means of economic achievement.  [39]  These themes do not seem to be taken into consideration by any other music genre. Some rappers to get more credibility claim to have been a real life pimps ( Ice- T, Snoop Dogg, Jay-Z, K-Luv). Pimping has a broader meaning in hip hop than just managing prostitutes. To pimp something can mean to sponsor it or to accessorize it. The term pimp is often used as a substitute for player, a man who mastered in seducing women or hustlers who show off with their nouveau riche assets  [40]  . This kind of a pimp chic imagery is a popular topic among rappers. Some even devote the whole song s to glamorize such lifestyle: The fancy cars, the women and the caviar. /You know who we are/cuz were pimpin all over the world.  [41]  There is also a number of rap songs in which we can find a lot of references to the standard definition of a pimp man who headhunts and employs prostitutes. Kubrins research takes into account this standard definition and notes that this theme was detected in 20 percent of the misogynistic songs.  [42]  Most of them contain the same message that women are good only to sell sex and men can usurp the right to access to their bodies: No need for rest haven these hoes Lets show em what they pussy made fo Lets me and you lay in these hoes And show em what they pussy made foà ¢Ã¢â€š ¬Ã‚ ¦ . Lets leave without payin these hoes And show em what they pussy made fo.  [43]   Such images are present even in RNB which is supposed to be focused more on the rhythm and music than less abundant in explicit lyrical content: Ace mizzy get all the hoes. /Gonna teach them shit they want to know. / Like fuck that pussy ass 9-4 girl./ Make that bucket a pot of gold.  [44]  These lyrics convey extremely disturbing misogynistic messages especially that hip hop aspires to be considered as a true voice of the urban ghetto. In that case, judging by the lyrics, the ghetto seems to inhabit pimps, pimps in training and prostitutes. While women are being described as sexual objects, men get the message to cherish the life of a pimp. Women seem to be painted with the same brush and not considered as an individual human beings. The only interaction between these two parties boils down to a scenario of what a pimp would do to a prostitute. Women Not to Be Trusted Another piece of advice, recurring in many hip hop songs, is the one that a man has to be careful of whom they put trust in. And women seem to be the least trustworthy. According to Kubrin and Weizer almost half of the misogynistic songs exposed such attitude of distrust towards women.  [45]  Another fact worth noticing here is that the lack of trust is directed at all women with no exception. All women in general are considered tricky evil creatures. For some rappers a question How could you trust a ho?  [46]  is rather a rhetorical one. Others unveil specific reasons why they cant trustem. In a song byà ¢Ã¢â€š ¬Ã‚ ¦ a young girl is not only promiscuous but also will surely lie to you about her age which will get you in trouble and most likely put you in prison: See nowadays man you got to know these bitches age/ Cause they ass be real fast when they be goin through that phase. / You fuck a girl thats young, and you gonna end up in the cage.  [47]  Women solidarity is c riticized. There will be no point in defending yourself as the mother will be on her little girls side: Cause her mom aint tryin to hear that you never knew her age.  [48]  Not only do women stand up for one another but will also try to get some material compensation from you. Some rappers, like Nas, warn that it is a bad idea to force women into having sex, not because of the atrocity of this act, but rape accusation that may follow: Dont take the pussy, if she fightin/ Cause you saw what happened to Tupac and Mike Tyson./ Specially if you large [famous], some hoes is trife [petty]/ Get you on a rape charge, have you servin your life.  [49]  Despite being convicted of rape, a legendary boxer Mike Tyson and rapper Tupac Shakur, were considered as the most celebrated heroes of the hip hop generation in 1990s. This fact well illustrates the gender conflict of that generation. During and after the trial, many black male church leaders defended Tyson claiming that the whole proc ess was an attempt of the white supremacist to destroy a well-known black man. The president of the National Baptist convention in USA was suspected for offering a bribe to the Tysons complainant. For a substantial back male part of the society the issue was not about gender but about racism.  [50]  This example proves of an extreme solidarity within African American male society. Countless hip hop lyrics strongly reinforce the idea of conspiracy theory that is supposedly drawn by the evil system and women. Tyson was accused and sentenced for a date rape on 18- year-old Miss Black Road Island. Tupac Shakur heard the same charges from his groupie whom he forced to have a group sexual intercourse with. These two events may have influenced a number of hip hop artists who eagerly express a lot of distrust in beautiful women. Such attitude against beautiful women permeates throughout many hip hop songs. It seems to be more than certain these ladies will try to deceive you with their looks and take advantage of you in no time. They are considered by the rappers to be decoys for set up. There are number of songs which describe such procedure: You know they [women] might be the one to set me up. / Wanna get they little brother to wet [kill] me upà ¢Ã¢â€š ¬Ã‚ ¦/ Bitches be schemin, I kid ya not. / Thats why I keep my windows locked and my Glock cocked.  [51]   Another way for women to set men up is to get pregnant. This seems to be not only the concern of the rappers, but also a common prejudice among the male in ghetto neighborhoods. Anderson states that to claim a child is against the street code of hit and run  [52]  . The rappers warn their male audience: Why plant seeds in a dirty bitch, waitin to trick me?/ Not the life for me.  [53]  Owning up to pregnancy means not only breech of the code but also commitment which is condemned by the peers. But the greatest concern of men would be paying child support: I aint lettin nothin leak cause if things leak, then Im a get caught/ And I cant get caught cause you know how they do it about that child support./ Shit, bitches is cold on a nigga who aint got his game tight/ Getting 18.5 percent [child support payments] half your life.  [54]  Generally speaking, collection of child support is a problem in the times of crisis, especially for unqualified African-American workers. A tough choice has to be made, whether to cater for your own needs or your childs. As the money for the children upbringing goes to their mothers pockets, the male frustration and resentment towards women grows. Being broke does not match the image of the self-proclaimed pimp or a player. No more player, no Shorty the Pimp I get paid, divert a check and get 40 percent. All the homies talkin bad, hair down, walkin sad Got the broad livin with me, baby sayin Dad!à ¢Ã¢â€š ¬Ã‚ ¦ I could try to mack again but the bitches wont want me Cause Im all washed up, broke, fat, and funky. I lost everything that I worked to be Never thought Id be a trick, payin hoes to serve me.  [55]   The lyrics make it obvious that women cannot be trusted because they are a hazard to men pimps. If they do not get you in prison or ridicule you in front of your peers and hinder your image of a thug, they well surely drain your pocket. And this is what rappers seem to be the most anxious about. Getting rich ( à ¢Ã¢â€š ¬Ã‚ ¦or die trying by 50Cent)  [56]  seems to be the mostly frequent motive of all. And the streets seem to be filled with gold diggers on the prowl only interested in you because of your money: Watch the honeys check your style/ Worthless, when they worship, what you purchase./They only see ice [diamonds], not me, under the surface/Whats the purpose?  [57]  Gold Digger by Kanye West may serve as the best example of a song that describes a seductive, yet greedy woman who takes advantage of men.  [58]  This type of a woman is mostly feared by those men who climbed up the social ladder, became businessmen, or celebrities and like to show off their recently acquired wealth. They (who?) are considered to be the easiest targets as they feel no limits for dispensing money and boast about their affluence. She (who is she?) is described as a very tricky cutie the bomb. Once she has set her sight on her super rich male target, the first thing she will try to do is charm him by her gorgeous looks, and seduce him. She will try to blend in his elite circle to get to him. In no time she will make him spend money on her and her friends and he will do it just to impress her. And if you expect to get a chance with her you would better comply with the rules of her game. Her main goal is to secure her life with her preys money. If she fails to drag his feet down the aisle, she will get pregnant just to get secure her life with his money anyway. Oftentimes it happens that after eighteen years of paying the child support the baby turns out to be not his. Whilst men in hip hop songs do not see anything wrong in taking advantage of women, they seem to fe ar of getting such favor returned by them. Their concern is also not to get ridiculed in front of other men. If that happens, Kanye West gives them a self explanatory answer back: she aint messin wit no broke niggaz.  [59]  There is also a message to black women in general in the last stanza of this song. No matter if you are a gold digger or you are being a down to earth girl and stick to your man regardless of his material status, there is a bad ending for you anyway. If he is ambitious enough, he will get rich sooner or later. However when it happens, he will: leave your ass for a white girl. This suggests that white women are ranked higher than black women in the hip hop social hierarchy. According to the findings of the study on the he effect of images of African American women in hop hop on adolescents sleek hair texture and lighter skin tone would be considered as the main determinants of female attractiveness  [60]  . These traits would be most sought for by both mal e and female who participated in the survey. Also historically these features were used as measures of social, political and economic significance for African Americans. Those who resembled European Americans would be located higher in the American social strata.  [61]  Such supposition may have influenced the pursuit of white women by black men. The image of a strong, emasculating black woman versus a pure and submissive Vi